ID: 1008719932

View in Genome Browser
Species Human (GRCh38)
Location 6:54336715-54336737
Sequence TAGGTTACTAAAGCTATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008719931_1008719932 -9 Left 1008719931 6:54336701-54336723 CCAAGGAGACTAATTAGGTTACT 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1008719932 6:54336715-54336737 TAGGTTACTAAAGCTATTACAGG No data
1008719930_1008719932 -8 Left 1008719930 6:54336700-54336722 CCCAAGGAGACTAATTAGGTTAC 0: 1
1: 0
2: 0
3: 8
4: 88
Right 1008719932 6:54336715-54336737 TAGGTTACTAAAGCTATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008719932 Original CRISPR TAGGTTACTAAAGCTATTAC AGG Intronic
No off target data available for this crispr