ID: 1008720742

View in Genome Browser
Species Human (GRCh38)
Location 6:54348053-54348075
Sequence CAGCTCTTATAGAAGACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008720742_1008720743 9 Left 1008720742 6:54348053-54348075 CCTTGTGTCTTCTATAAGAGCTG 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1008720743 6:54348085-54348107 AAAGCTGAGTTATTCAGCTAAGG 0: 1
1: 0
2: 2
3: 10
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008720742 Original CRISPR CAGCTCTTATAGAAGACACA AGG (reversed) Intronic
900940725 1:5796934-5796956 CAGGTTTTCTAGGAGACACAAGG + Intergenic
903317604 1:22520798-22520820 CAAATCTTATAGATGCCACAAGG - Intronic
903783669 1:25841149-25841171 TAGCTCTCTTAGAAGACCCATGG + Intronic
904178630 1:28649724-28649746 AAACTCTTAGAGAAAACACAGGG + Intergenic
904342279 1:29844466-29844488 CACTTCTTATAGAAGACCCTGGG - Intergenic
904559336 1:31386233-31386255 AAGCTCTGATAGAAGGTACAGGG + Intergenic
907947025 1:59145233-59145255 CAGGTCATAAAGAAGACAGAGGG - Intergenic
919411570 1:197250867-197250889 CAGCTCTTCCAGGAGACACAAGG - Intergenic
919976270 1:202615089-202615111 GAGCTCTTATGAAAGACAGACGG + Intronic
920626431 1:207606184-207606206 CAGCCAGTATAGAGGACACAGGG + Intronic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
922819602 1:228475009-228475031 CTCCTTTTATATAAGACACAGGG + Intergenic
923270107 1:232347822-232347844 CTGCTCCTATAGGAAACACATGG + Intergenic
1063353335 10:5375531-5375553 CCACTCATATAAAAGACACATGG + Intergenic
1070721524 10:78760480-78760502 CAGCTCTTATAAATGCCACCAGG - Intergenic
1072776029 10:98194885-98194907 CAGCTCCTATGGAAAACATATGG + Intronic
1074475714 10:113772249-113772271 CAGCTGTAATACAAGACAGAGGG + Intronic
1074505729 10:114068745-114068767 CTGATTTTATAGAAAACACATGG + Intergenic
1076150303 10:128156927-128156949 CAGCTTTTCTTGAAGACACAAGG - Intergenic
1076756973 10:132577596-132577618 CAGCTCTTAGAGGTGACATAGGG + Intronic
1079504377 11:21137032-21137054 CAACTCTTACAGAAGAGAGAAGG + Intronic
1079661028 11:23036733-23036755 TAGATCTGATAGAAGACATAAGG + Intergenic
1080392603 11:31862146-31862168 CAGATAAAATAGAAGACACACGG - Intronic
1084283812 11:68118583-68118605 TAGCTTTTAAAAAAGACACAAGG - Intronic
1084304791 11:68274961-68274983 CAGCTCCTAGGGAAGATACAGGG + Intergenic
1085419264 11:76341547-76341569 CTGCTCTTATTGATGTCACACGG + Intergenic
1086096270 11:83052994-83053016 CACCTCAGAGAGAAGACACAGGG + Intronic
1088501750 11:110490346-110490368 CATCTCTAATAGTAGAGACAGGG + Intergenic
1088562658 11:111131454-111131476 CAGCTCTTATTTTAGATACAGGG + Intergenic
1089126826 11:116182209-116182231 CAGCTCCTAGATAAGACTCATGG + Intergenic
1089474358 11:118746350-118746372 GAGTTTTTATAGAAGGCACAAGG + Intergenic
1090932093 11:131307058-131307080 CTTCTCTCACAGAAGACACATGG + Intergenic
1091649057 12:2295969-2295991 CTGCTCTCATAGGAGAGACATGG - Intronic
1094252671 12:28382898-28382920 TAGCTCTTATTCAAGTCACAAGG + Intronic
1100194497 12:92228777-92228799 CAGCCATTAAAGAGGACACAGGG - Intergenic
1101196929 12:102393206-102393228 CAACTCTCCTAGAAAACACACGG + Intergenic
1101755148 12:107615676-107615698 GAGCTGTTTCAGAAGACACATGG - Intronic
1105802500 13:23920319-23920341 CAGTTCTCAAAAAAGACACAGGG + Intergenic
1107835718 13:44411046-44411068 CATGTCCTATAGAAGACACAGGG + Intergenic
1109593040 13:64512355-64512377 CTGTTCTTATAGCAAACACATGG - Intergenic
1111493780 13:89021202-89021224 CAGCTCTTAAAGAAGAGCCAAGG + Intergenic
1116372644 14:44155072-44155094 CAGCCCTTCTAGAAGAACCAGGG - Intergenic
1117974379 14:61282776-61282798 CAGGTATTATAGAAGACTGAGGG + Intronic
1118133445 14:62994409-62994431 CATCTCTTTTAGAACACATATGG + Intronic
1119958032 14:78821999-78822021 CATATCTGATAGAAAACACAAGG + Intronic
1122474606 14:101998302-101998324 CAGCTCTTATAGAGGGGAGAGGG - Intronic
1124166539 15:27331158-27331180 CAGCCCTTTTGGAAGACACCTGG + Intronic
1125482518 15:40090466-40090488 CAGCTCCGATAGCAGGCACAGGG - Exonic
1126679021 15:51186396-51186418 CAGCTCTCATAGCAGGCAGATGG + Intergenic
1129522608 15:76195372-76195394 CAGCTCCCAGAGAAGACGCAGGG - Intronic
1129972511 15:79791527-79791549 CAGAAATTATAGAAGACAAAAGG + Intergenic
1131385856 15:92006591-92006613 CAGCTCATCTTAAAGACACAAGG - Intronic
1134785140 16:16935376-16935398 CAGCTCTTAGAGGAAATACAAGG + Intergenic
1135863520 16:26079261-26079283 CTGGACTTATAGAAGCCACAGGG + Intronic
1138643417 16:58404772-58404794 CAGCTCCTATCAAGGACACACGG - Exonic
1138964309 16:62065903-62065925 CAACTCTTATGTAAGACACCTGG - Intergenic
1139791882 16:69444290-69444312 CAGCTCTCAGTGAAGACAGAGGG - Intronic
1140513563 16:75526061-75526083 TACCTCTTACTGAAGACACAGGG + Intergenic
1141342196 16:83213421-83213443 CAGACCTTCTAGAAGAAACAAGG - Intronic
1142005323 16:87687045-87687067 CAGCGCTTGTAAAAAACACACGG - Intronic
1144696960 17:17311024-17311046 AAACTCTTAAAGAAAACACAGGG - Intronic
1148486958 17:47996698-47996720 CAGCTCCTAAGGAAGAAACACGG + Intergenic
1152379968 17:79937296-79937318 CAGCTCTTTTGGAGGCCACAGGG - Exonic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1156604729 18:38652896-38652918 CTGCTCTAAGAGAAGGCACACGG + Intergenic
1156816268 18:41315315-41315337 CAGCTCTTTTATAAGAGCCATGG - Intergenic
1157330259 18:46698871-46698893 CAGCTATAATAGAGGAAACAAGG + Intronic
1158009043 18:52707424-52707446 CAGCCATTATAGAAAACATAGGG + Intronic
1161611818 19:5247530-5247552 CAGGTCCTAAAGAAGACACATGG + Intronic
1165972592 19:39644940-39644962 CAGCTCTTATAGAGGGAAAAGGG - Intergenic
925110205 2:1328595-1328617 CAGATCTTAGAGGAGACAGATGG + Intronic
926623527 2:15070296-15070318 CAGCTCTTTTTGTATACACAGGG + Intergenic
927532436 2:23820273-23820295 CAGTTCTTATAAAAGCAACAAGG + Intronic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
936121989 2:109754930-109754952 CAACTCTTGTAGGACACACAAGG - Intergenic
936222706 2:110616542-110616564 CAACTCTTGTAGGACACACAAGG + Intergenic
937173069 2:119896730-119896752 TAGTTCATATAGAAAACACATGG + Intronic
937710492 2:124975357-124975379 TAGCTCTCATTAAAGACACATGG - Intergenic
937823708 2:126341284-126341306 CAGTTCTTACAAAAAACACAAGG + Intergenic
943335576 2:186609410-186609432 TAGCTTTTAAAGAAGACAGATGG + Intronic
944590905 2:201217218-201217240 CAGGTCTTAGAAAAGACACCAGG - Intronic
947133799 2:226956366-226956388 CAGCTATTACTAAAGACACAAGG - Intronic
1175457496 20:59126567-59126589 CAACTCTTAGAGGAGACAAAGGG - Intergenic
1175835701 20:61993060-61993082 CAGCTCATAGAGGAGACGCAGGG - Intronic
1177224931 21:18242247-18242269 AAGGTGTCATAGAAGACACATGG - Intronic
1177733414 21:25058570-25058592 CAGCTCTTTTGTAAGGCACAAGG + Intergenic
1178031996 21:28538534-28538556 CAACTTTTATTGTAGACACAGGG + Intergenic
1179491285 21:41743170-41743192 CAGCTCTGATGGAAAATACAGGG - Intronic
1180787476 22:18554881-18554903 CATCTGTTAGAGCAGACACACGG + Intergenic
1181234264 22:21440424-21440446 CATCTGTTAGAGCAGACACACGG - Intronic
1181244384 22:21494407-21494429 CATCTGTTAGAGCAGACACACGG + Intergenic
1184397332 22:44250533-44250555 TTGCTCTTATAATAGACACAGGG - Intronic
949646402 3:6100208-6100230 CAGCTTTTATAGAAAGCACTAGG - Intergenic
949950630 3:9225889-9225911 CAGCTTTTATAAAAGTCAGAAGG - Intronic
953836670 3:46352108-46352130 CAGGTCTTACACAGGACACATGG + Intergenic
957527473 3:81395675-81395697 CAGCTGTTATATAATACTCATGG - Intergenic
962423362 3:135247984-135248006 CCGCTCTTTAAGAAGACATAGGG - Intronic
965281264 3:166756605-166756627 CATCTCTTCTAGAAAACAGAAGG + Intergenic
967415510 3:189213463-189213485 AAGCCCTTATAGAACACAGAAGG - Intronic
967665641 3:192168728-192168750 CAACTATTATAGAAGACAAAGGG + Intronic
967719024 3:192795787-192795809 CAGCTCTTAGATAAAATACACGG + Intergenic
969047305 4:4345775-4345797 CAACTCTTATAGCAGCCTCACGG + Intergenic
970597949 4:17617027-17617049 CTGCTCTGATAGAAGAAACCTGG + Intronic
972252957 4:37324140-37324162 CAACTCTTATTTTAGACACAGGG - Intronic
974622480 4:64378170-64378192 GAGCTGTTTTTGAAGACACAAGG + Intronic
974761991 4:66289014-66289036 TAGCTCTTTTAGTAGACTCAGGG - Intergenic
974831587 4:67195812-67195834 CAGCTCTGATAGCAGACTTAAGG + Intergenic
977552062 4:98452574-98452596 GAGCTCTTAGAGAAGGCAGAGGG + Intergenic
978920470 4:114177059-114177081 CAATTCTTATATAAGACAAAAGG + Intergenic
980612446 4:135176948-135176970 CAGCTCTTCAACAAGACACTTGG - Intergenic
981953864 4:150446442-150446464 CAGCTCTTATGTATGACCCATGG - Intronic
982697670 4:158621981-158622003 CAGCTATTATGGAAAACATATGG + Intronic
982912902 4:161167172-161167194 CAGCTCTTTTATAAGAGAAAAGG + Intergenic
983479106 4:168251547-168251569 CAGGTCTTAAAGAAGAAATACGG + Intronic
984079026 4:175219667-175219689 CAGGTCATCAAGAAGACACATGG - Intergenic
984627441 4:182023277-182023299 CAGCTTTGATATAAGACACTTGG + Intergenic
985033691 4:185817857-185817879 AAGCACTTCTAGAAGACACAAGG - Intronic
985324495 4:188752950-188752972 GCGGTCTTATAGAAGACAAAGGG + Intergenic
986349544 5:6865124-6865146 CAGGTCTTATAGAAGTTGCAAGG - Intergenic
988419602 5:30989263-30989285 CACCTCTAATAAAAGACAGATGG + Intergenic
988808583 5:34763354-34763376 CAGGTCTTAGAAAAGACATAGGG - Intronic
992149124 5:73884392-73884414 CAGGTCTTATAGATCCCACAAGG - Intronic
993979725 5:94530767-94530789 CAGCTCTGAAAGCAGAAACAGGG - Intronic
995262529 5:110122403-110122425 CAGCTCTTATTCAAGGCCCAAGG + Intergenic
998749492 5:145303460-145303482 AAGCTCTTATAGAGAACTCATGG + Intergenic
1000686868 5:164261128-164261150 CAGATATTAAAGAAGATACATGG + Intergenic
1005438792 6:25842677-25842699 CAACTCTCATTGAAGACTCATGG - Intronic
1008720742 6:54348053-54348075 CAGCTCTTATAGAAGACACAAGG - Intronic
1010037956 6:71347560-71347582 CCTCTCTTATAGAAAACAAATGG + Intergenic
1010926030 6:81747439-81747461 CAGCTCTGACAGAATTCACAAGG + Exonic
1011835891 6:91431332-91431354 GAGCTCATTTAGAATACACAGGG - Intergenic
1014947111 6:127512169-127512191 CTGTTCTTTTAGAAGACTCATGG + Intronic
1015864724 6:137716574-137716596 CAGGTCTTATAGAAGAGGCGAGG + Intergenic
1015969449 6:138729775-138729797 CAGATATTGAAGAAGACACATGG - Intergenic
1018279471 6:162170086-162170108 CAGCTGTTATAGGAAACCCAGGG - Intronic
1020472530 7:8555363-8555385 CACCTCTGACAGAAGACACCAGG + Intronic
1022759283 7:33329754-33329776 CAGCTGTTAGAGAAGGTACACGG - Intronic
1024548348 7:50540572-50540594 CAGCTCCTCTAGAAGAGCCAGGG - Intronic
1027816663 7:82981259-82981281 CAGATCTTAAAGAATACAGAGGG + Intronic
1028047602 7:86142445-86142467 TAGGACTTATAGAAAACACAAGG - Intergenic
1031573864 7:123392416-123392438 CAGCTCTGATAGAAGTAACAAGG + Intergenic
1037274644 8:17164964-17164986 CAGCTCTTTGAGAGGACTCATGG - Intronic
1037297818 8:17419721-17419743 AAGCTCTAATTGAAGACTCATGG + Intergenic
1039120834 8:34144516-34144538 GAGCTCTTTTAGAAGAAAAATGG + Intergenic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1043571781 8:81611938-81611960 CAGCTGAAATGGAAGACACAAGG + Intergenic
1043738243 8:83774772-83774794 CAGCTCTTACAGACCACAGAGGG + Intergenic
1045782318 8:105881520-105881542 CAGCTATTAGAGACCACACAGGG - Intergenic
1046371943 8:113321255-113321277 TAGCTATTATATAAGATACATGG - Intronic
1049895922 9:112079-112101 CAGCAGATAAAGAAGACACAAGG + Intergenic
1051331355 9:16027813-16027835 CAGCTCTTATACAACCAACAGGG - Intronic
1052398543 9:27971796-27971818 CATCTCTTAGAAAAGAAACACGG + Intronic
1053739104 9:41122262-41122284 CAGCAGATAAAGAAGACACAAGG + Intergenic
1054689246 9:68309060-68309082 CAGCAGATAAAGAAGACACAAGG - Intergenic
1054811987 9:69442320-69442342 CAGCTCTTATAGCAGGGCCAGGG - Intronic
1055992219 9:82119161-82119183 TAGCTCTTATCGAACAGACATGG + Intergenic
1059652249 9:116325657-116325679 CAGCTTCCATAAAAGACACAGGG + Intronic
1059803034 9:117770288-117770310 CAGCTCTGAAAGAGGACAAAGGG + Intergenic
1060501296 9:124158142-124158164 CAACTCTTACAGAAAACAAAGGG - Intergenic
1060673419 9:125490770-125490792 CTGGGCTTATAGAAGACACCTGG - Intronic
1062245776 9:135565358-135565380 CAGCTCTCATGGAAGCCCCAGGG + Intronic
1185833059 X:3319807-3319829 CAGCTTTTATTTTAGACACAGGG - Intronic
1185923654 X:4122728-4122750 GAGCTCTTTTTGAAGACTCATGG - Intergenic
1186603913 X:11068898-11068920 CATCTCTTTTAGAAGATACCAGG + Intergenic
1187294541 X:17986079-17986101 CAGCTCCCAAAGAACACACACGG - Intergenic
1187329520 X:18324128-18324150 CAACTATAAGAGAAGACACATGG + Intronic
1189263783 X:39698131-39698153 CAGCTCCTTTAGCAAACACAAGG + Intergenic
1189851375 X:45179457-45179479 CAGATATTATAGTAGAAACAAGG + Intronic
1193567151 X:83090891-83090913 CAGCACTTATAATAGAGACATGG - Intergenic
1194405243 X:93488697-93488719 CAACTCTTATAAAAAATACATGG + Intergenic
1196508460 X:116476948-116476970 CAGCTCTTATACAAGATGCAAGG + Intergenic
1198245408 X:134826434-134826456 CAGATTTTATATAAGAGACAAGG - Intronic
1198649181 X:138842264-138842286 GATCTCCTATAGTAGACACAGGG + Intronic
1201568904 Y:15393508-15393530 CAGCTCTTAAAGGTGGCACATGG + Intergenic