ID: 1008721877

View in Genome Browser
Species Human (GRCh38)
Location 6:54364022-54364044
Sequence TTTTATCTTTAGGAGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008721877 Original CRISPR TTTTATCTTTAGGAGCTAGA AGG Intronic
900346297 1:2212079-2212101 TTGTATTTTTAGGAGCGACAGGG + Intronic
901446942 1:9314309-9314331 TTGTATATTTAGGAGCGGGAGGG - Intronic
901622785 1:10602201-10602223 TTTTATTTTTAGGGGCTGGAAGG - Intronic
902881351 1:19373865-19373887 TTTTATTTTTTGGAGGTACAGGG + Intronic
903790571 1:25890179-25890201 TTAGATCTTCAAGAGCTAGAAGG - Intronic
904029693 1:27526424-27526446 TTGTATTTTTAGTAGCAAGAGGG + Intergenic
904104064 1:28062448-28062470 TTTACTCTTTAGAAGTTAGAAGG + Intronic
905271233 1:36789133-36789155 GTTTTTCTTCAGGAGGTAGAAGG - Intergenic
905635448 1:39548330-39548352 TTATAACCTTAGGAGATAGAAGG + Intergenic
905715890 1:40149572-40149594 TTGTATTTTTAGGAGATACAGGG - Intergenic
907104856 1:51873681-51873703 TTTTATTTTTAGTAGCGACAGGG + Intronic
907195476 1:52683055-52683077 TTGTATCTTTAGTAGAGAGAGGG + Intergenic
909499165 1:76314049-76314071 GCTTTTCTTTAGGAGCCAGAGGG + Intronic
911802132 1:102155334-102155356 TTTTATCTTTAGTAGAGACAGGG - Intergenic
912035289 1:105304888-105304910 CTTTATCTTTGGTAGCAAGATGG - Intergenic
912172478 1:107117344-107117366 TTTGATCTCTTGGAGCTGGATGG + Intergenic
913148310 1:116014194-116014216 TTTCCTCTTTAGGAACTGGAAGG + Intronic
915499408 1:156304641-156304663 TTGTATTTTTAGTAGCTACAGGG - Intergenic
915749700 1:158194677-158194699 TTTTATCTTTAAAAGCTAGGGGG - Intergenic
915866925 1:159511206-159511228 TTCTATCTTAAAAAGCTAGATGG - Intergenic
915880491 1:159665995-159666017 TTTTATTTCCAGGAGCTATAAGG + Intergenic
917544799 1:175952734-175952756 TTTTATTTTTAGTAGCAACAAGG - Intronic
917560735 1:176152251-176152273 TTTTTTTTTTAGGAGAGAGAAGG - Intronic
918480107 1:184969381-184969403 TTTTATCTTGATGAGCAGGAGGG - Intronic
918686400 1:187421264-187421286 TTGTATCTTTAGTAGCGATAGGG + Intergenic
918904596 1:190476149-190476171 TTTTATGTCTGGGAGCTAAAAGG + Intronic
919024245 1:192147660-192147682 TGTTATCTATAGGAGCGATAGGG - Intergenic
919212094 1:194500173-194500195 TTTTATTTTTAGTAGATACAGGG + Intergenic
919610581 1:199741219-199741241 TTTTTTCTTGAGCAACTAGAAGG - Intergenic
919677945 1:200405257-200405279 CTTTAGCTTTAGCAGCTAAAGGG - Exonic
919734091 1:200934515-200934537 TTTTCTCTTTAGAAACGAGAAGG + Intergenic
920923785 1:210322340-210322362 TTTTATCTTTAGTAGAGAGAAGG - Intergenic
921771226 1:219042195-219042217 TGTTATCTATAGGAGCAAGTGGG - Intergenic
922531413 1:226348133-226348155 TTTTATCTGTTGGAGCTGGAAGG - Intergenic
923094522 1:230763991-230764013 TTTTATGTTTAGAAACTAGATGG - Intronic
923445464 1:234066614-234066636 TTTTATCTTTGGGAAGGAGAAGG - Intronic
923475421 1:234326969-234326991 TGTGATCGTTTGGAGCTAGAGGG + Intergenic
924322833 1:242866660-242866682 TTTTCTATTTAGGAAGTAGAAGG + Intergenic
924497909 1:244607932-244607954 TTTTATTTTTAGGAGATATGGGG - Intronic
1063080177 10:2760475-2760497 TTTTGTCTTAAGGAACTAGAAGG + Intergenic
1063980381 10:11447431-11447453 ATTTATCTTTGGAATCTAGATGG - Intergenic
1064608551 10:17071961-17071983 TTTTCTCTTTAGGTTCGAGATGG - Exonic
1065595803 10:27309857-27309879 TTATATCTTTAGGAGAGAGGAGG - Intergenic
1066474496 10:35731790-35731812 TTTCATCATTAGTAGCTAAATGG - Intergenic
1066538744 10:36421060-36421082 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1068653494 10:59550050-59550072 TGTTATCTATAGGAGCCATAAGG + Intergenic
1068837730 10:61572404-61572426 GTGACTCTTTAGGAGCTAGAGGG - Intergenic
1068949084 10:62759695-62759717 ATTTATCTTTAGGAAGAAGAAGG + Intergenic
1070537218 10:77388803-77388825 TTGTATCTCTTGGTGCTAGAAGG + Intronic
1071689853 10:87805616-87805638 TTTTATGTTTAGTAGCATGAAGG - Intronic
1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG + Intergenic
1074341929 10:112640572-112640594 ATTTATCTATAGAAGCTAGTGGG - Intronic
1076213281 10:128670083-128670105 TTGTATTTTTAGGAGAGAGAGGG + Intergenic
1078192415 11:9102352-9102374 TTTTATCTTTTGGAGAGACAAGG - Intronic
1078702428 11:13699284-13699306 TTGTGTCTTTAGAATCTAGAAGG + Intronic
1079992765 11:27263981-27264003 TTTTTTTTTTAGGAAATAGAAGG - Intergenic
1080380944 11:31771803-31771825 TTGTATCTTTAGTAGATACAGGG - Intronic
1081359575 11:42158141-42158163 TATTATGTTTAGGAGCTATTCGG - Intergenic
1082910683 11:58370870-58370892 TATTTTCTTTAGGAGATAAAAGG - Intergenic
1083559857 11:63664778-63664800 TTGTATTTTTAGTAGATAGAAGG + Intronic
1083565307 11:63710383-63710405 TTTTATCTTTCAGAGCAAGATGG - Intronic
1083643483 11:64158414-64158436 TTTTATTTTTAGGAGAGACAAGG + Intronic
1084663539 11:70561861-70561883 TTCTACCTTTAGAAGCTAAAAGG - Intronic
1085150576 11:74249820-74249842 TAACAACTTTAGGAGCTAGAAGG + Intronic
1086420309 11:86631903-86631925 TTGTATTTTTAGGAGAGAGAGGG + Intronic
1087527855 11:99340103-99340125 TTTGTTCCTTAGGAACTAGAGGG + Intronic
1088321027 11:108554747-108554769 TTGTATCTTTAGTAGATAGGGGG - Intronic
1088653845 11:111980321-111980343 TAGTAGCTTTTGGAGCTAGAAGG - Intronic
1089796739 11:120986649-120986671 TTTTTTCTGTAAGAACTAGACGG - Exonic
1090370552 11:126248540-126248562 TTTTATTTTTAGTAGAGAGATGG + Intronic
1090613259 11:128490890-128490912 TTTTATTTTTAGGAGAGACAGGG + Intronic
1092561893 12:9623851-9623873 TTATATATTTAGGAGCTATTAGG + Intergenic
1092800542 12:12161440-12161462 TTTTATCTTTAGTAGTTACGGGG + Intronic
1093506385 12:19871633-19871655 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1093879330 12:24385651-24385673 TTTTATCTTTAAGATTTATATGG + Intergenic
1094539127 12:31348366-31348388 TTTTATTTTTAGTAGCGACAGGG + Intergenic
1094592379 12:31833822-31833844 TTTTACCTTTAGCGGATAGAAGG + Intergenic
1096382236 12:51168655-51168677 TTTTATTTTTAGTAGAGAGAGGG + Intronic
1098291910 12:68964563-68964585 TGTTATCTATAGGAGCAATAGGG - Intronic
1098595038 12:72263107-72263129 TTTTATTTTTATGAACTATATGG - Intronic
1099339998 12:81418612-81418634 TTTTGGCTTTATGAGCCAGATGG - Intronic
1099563282 12:84206254-84206276 TTTTATCTTTAGTAGAGACAGGG + Intergenic
1100003152 12:89861500-89861522 TTTTCTCTTTAGCAGCTTTATGG - Intergenic
1100680725 12:96917019-96917041 TTTTATCTTGAGAAACTGGATGG + Intronic
1101196734 12:102391434-102391456 TTTTATTTTTAGGAGAGATAAGG + Intergenic
1101508989 12:105375776-105375798 TTTTATTTTTAGTAGAGAGACGG + Intronic
1101803676 12:108044741-108044763 TTTTCGCTTTAGGGTCTAGAAGG - Intergenic
1103599916 12:122048073-122048095 TTTTATTTTTAGTAGCGACAGGG + Intronic
1103669363 12:122599521-122599543 TTTTATATTTAGCAGCAATAGGG + Intronic
1103849557 12:123923324-123923346 TTTTGGCTTTGGAAGCTAGATGG - Intronic
1104066010 12:125306524-125306546 TTTTAGCCTGAGAAGCTAGAAGG - Intronic
1105392759 13:19996408-19996430 TTTTATCTTTAGTAGAGACAAGG - Intronic
1105975661 13:25469818-25469840 TTTTATCCTTAGTAGTCAGATGG - Intronic
1106605792 13:31227657-31227679 GATTATTTTTAGGATCTAGATGG + Intronic
1108605932 13:52038607-52038629 TTTTATTTTTAGCAGCTAGGAGG + Intronic
1108888958 13:55228906-55228928 TTTTAGCTTGAGGGGTTAGAAGG + Intergenic
1109874895 13:68388116-68388138 TTTTATTTTTAGTAGAGAGACGG - Intergenic
1110536381 13:76655245-76655267 TTTTAACTTGAGCAACTAGAAGG + Intergenic
1110971078 13:81762048-81762070 ATTTATATTTATGACCTAGAAGG + Intergenic
1111131859 13:83987031-83987053 TTTTATCTTTGGAAGAGAGAAGG + Intergenic
1112849667 13:103689539-103689561 TTAATTCTTTAGGAGCTACAAGG + Intergenic
1112930100 13:104724224-104724246 TTTTATTTTAAGAAGCTATATGG - Intergenic
1113083724 13:106545671-106545693 TTTTATCTTAAGTAGCAAAAAGG + Intronic
1115595490 14:34904859-34904881 TTTTATCTGGGGGACCTAGAGGG - Intergenic
1115684928 14:35786752-35786774 CTTTATTTTTAAAAGCTAGAAGG + Intronic
1116324042 14:43508714-43508736 TTTTTTCTTTAGGTGCTAATAGG - Intergenic
1116818231 14:49603015-49603037 TTTTATCTTTAGTAGAGACAGGG + Intronic
1116897830 14:50334559-50334581 TTTTACCTTTAGGAGCCCCAGGG + Exonic
1117146921 14:52845072-52845094 TTTTCTCTAGAGGACCTAGATGG + Intergenic
1117403446 14:55378878-55378900 TTTTATTTTTAGTAGCGACAAGG + Intronic
1118484234 14:66198647-66198669 TTTTCTCATAAGGAGCTATAAGG + Intergenic
1118954586 14:70468469-70468491 TTGTATTTTTAGGAGAGAGAGGG - Intergenic
1120030980 14:79640613-79640635 TTTTCTTTATAGGAGCTAAATGG - Intronic
1120147567 14:80995872-80995894 TTTTTTCTTTTGTAGCAAGAAGG - Intronic
1121808832 14:96859742-96859764 TTTTGGCTTGAGGAGCTAGAAGG + Intronic
1122026089 14:98878308-98878330 TTTTGTCTTTATGAGTTATATGG - Intergenic
1122576933 14:102748752-102748774 TTTTATCTTTTGTAGAGAGAGGG + Intergenic
1122728276 14:103775445-103775467 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1124802692 15:32849603-32849625 TTTTATCTAAAAGGGCTAGAGGG - Intronic
1125810288 15:42534301-42534323 TTTTATCTTTAGTAGAGACAGGG + Intronic
1126390601 15:48146376-48146398 TGTTACCTTTAGGGGCTTGATGG + Intronic
1126810753 15:52401240-52401262 TTGTATCTTTAGTAGAGAGAGGG + Intronic
1127005530 15:54565039-54565061 TTTTAACTTTAGCAGCCAGTAGG - Intronic
1127886975 15:63210039-63210061 TTTTATCTTTAAAAGATAAATGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130748752 15:86686609-86686631 TTGTATCTTTAGTAGATACAAGG + Intronic
1132086505 15:98912423-98912445 TTTTATATTTATCAGCTAAAAGG - Intronic
1132219700 15:100096251-100096273 TTTCATATTTAAGGGCTAGATGG - Intronic
1132541821 16:513686-513708 TCTTAGCTTTAAGAGCTGGAAGG - Intronic
1133943176 16:10327407-10327429 TTTTATTTTTAGGAGGGACAGGG + Intronic
1134266110 16:12694031-12694053 TTGTATTTTTAGAAGCTATAGGG - Intronic
1135638688 16:24101079-24101101 TTTTATCTATAGGAGCAATTGGG + Intronic
1135705868 16:24674238-24674260 TTTTATTTTTAGTAGCAACAAGG + Intergenic
1137990873 16:53153706-53153728 TTTTATTTTTAGTAGAGAGAAGG + Intronic
1138118352 16:54378272-54378294 TTTTATCTTTCTGAGTCAGAGGG - Intergenic
1138441605 16:57038428-57038450 TTTTATTTTTAGTAGAGAGAGGG + Intronic
1139635115 16:68253859-68253881 TTTTATTTTTAGTAGCAACAAGG + Intronic
1140903020 16:79387364-79387386 TTATATCCTTACTAGCTAGATGG + Intergenic
1141105271 16:81228326-81228348 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1141328209 16:83082450-83082472 TTTTATTTTTAGTAGATACAGGG - Intronic
1141362073 16:83405122-83405144 TTTTTTTTTTGAGAGCTAGAGGG - Intronic
1141783213 16:86178880-86178902 TTTTATTTTTAGGAGAGACATGG - Intergenic
1142662174 17:1438467-1438489 TTTTATCTTTGACAGCTAAAAGG + Intronic
1143019433 17:3909202-3909224 TTTTATTTTTAGTAGAGAGAGGG + Intronic
1143640646 17:8195036-8195058 TTTTATCTTTAGTAGAGACAGGG + Intergenic
1145284026 17:21490479-21490501 TTTTATTTTTAGTAGATACAGGG + Intergenic
1145393421 17:22475035-22475057 TTTTATTTTTAGTAGATACAGGG - Intergenic
1146270288 17:31480613-31480635 TTTTATTTTTAGTAGAGAGAGGG - Intronic
1148668787 17:49394688-49394710 TTGTATCTTTAGGAGAGACAGGG + Intronic
1148863524 17:50617019-50617041 TTTTATTTTTAGTAGATACAGGG + Intronic
1149189150 17:54037637-54037659 TTTTATCTTGAGGAGTAAAAGGG - Intergenic
1149880611 17:60286698-60286720 TGTTATCTTTAGTTGCTATAGGG - Intronic
1150019376 17:61595283-61595305 TTTTTTTTTTAGTAGCTAGGAGG + Intergenic
1150257556 17:63760253-63760275 TTTTATCTTTGGCAGATAGCTGG - Intronic
1150327104 17:64265970-64265992 TTTTATTTTTAGTAGATACAAGG + Intergenic
1152283179 17:79397306-79397328 TTTTATTTTTAGGAGAGACAGGG - Intronic
1152859541 17:82687897-82687919 TTTTATTTTTAGTAGAGAGAGGG - Intronic
1153296568 18:3551978-3552000 TTTTATTTTTTGTAGATAGAGGG + Intronic
1154511992 18:15115463-15115485 TTTTATCTTTAGTAGAGACAGGG + Intergenic
1155436971 18:25823601-25823623 TTATATCTATAGGAACTAAATGG + Intergenic
1155663595 18:28281182-28281204 TGTGATCTTTAGGAAATAGAAGG + Intergenic
1156167013 18:34434017-34434039 CTTTATCCTTAGGAACTACATGG - Intergenic
1156232695 18:35169858-35169880 TTTTGTCTTGAGGAACTATAAGG - Intergenic
1156332444 18:36136045-36136067 TTTTGTCCTTAGGAGATATATGG + Intronic
1156509488 18:37624580-37624602 TTTTTTCTTTGGTAACTAGAAGG + Intergenic
1157212213 18:45753259-45753281 CTATACCTTTAGGAGCTAAAGGG + Intergenic
1158476307 18:57782983-57783005 TTTTATTTTTAGTAGCGACAGGG + Intronic
1161285149 19:3464708-3464730 CTTTCTCTTTAGGAGCGAGCGGG - Intronic
1162130660 19:8524244-8524266 TTTTATCTTTAGTAGAGACAAGG - Intronic
1162163267 19:8734744-8734766 TTTTATTTTTAGGAGAGACAAGG - Intergenic
1162456065 19:10785611-10785633 TTTTATCTTTTGTAGAGAGAAGG + Intronic
1164160375 19:22622511-22622533 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1165499659 19:36178287-36178309 TTGTATTTTTAGTAGCTACAGGG - Intergenic
1166749380 19:45157586-45157608 TTTTATCTTTTGTAGATACAGGG + Intronic
1167495587 19:49816655-49816677 TTTTATTTTTAGTAGTTAGAAGG + Intronic
1168006176 19:53489427-53489449 TTGTATTTTTAGTAGATAGAGGG - Intronic
1168441946 19:56376111-56376133 TTTACTGTTTAGGAGCTAAAGGG - Intronic
1168707544 19:58478489-58478511 TTGTATCTTTAGTAGATACAGGG - Intronic
925067679 2:941179-941201 TTTTATCTTTACCAGATGGAGGG - Intergenic
925543823 2:4996077-4996099 TTGTATCTGTAGGTGCCAGAGGG - Intergenic
926309832 2:11667515-11667537 TTTTATTTTTAGGAGAGACAGGG + Intronic
926544157 2:14218293-14218315 TTTTATTTTTAGGAGATATAGGG - Intergenic
927422320 2:22946593-22946615 TTATATCTTTGGGAGCCAGTGGG + Intergenic
927745006 2:25610880-25610902 TTTTATTTTTAGTAGATACAGGG + Intronic
928153711 2:28856807-28856829 TTTTATCTTTAGCAGAGACAGGG + Intronic
929989395 2:46772758-46772780 TATTGTCCTTAGGACCTAGATGG + Intergenic
930513089 2:52370896-52370918 TTTTATCTTTAGTAGAGACAGGG - Intergenic
931281492 2:60796935-60796957 TTGAGTGTTTAGGAGCTAGAGGG + Intronic
931398320 2:61907861-61907883 TTTTATTTTTAGTAGCGACAGGG + Intronic
932154157 2:69400374-69400396 TTTTATATTCCGGAGGTAGAAGG - Exonic
932873468 2:75426715-75426737 ATTTATATTTAGAATCTAGACGG - Intergenic
933358451 2:81245433-81245455 TTTTAACTTGAGCAACTAGATGG + Intergenic
933667745 2:84978167-84978189 TTGTATTTTTAGTAGATAGAGGG + Intronic
933825379 2:86155269-86155291 TTTTATTTTTATGAGATTGACGG - Intronic
933900617 2:86847107-86847129 TTGTATCTTTAGTAGAGAGAGGG + Intronic
934479734 2:94624748-94624770 TTTTATCTTTAATATCTAAATGG - Intergenic
934603063 2:95672966-95672988 TCTTTGCTTTAGGATCTAGATGG - Intergenic
935324176 2:101921041-101921063 TTTTATCTTTAGTAGACACAGGG + Intergenic
935590069 2:104838885-104838907 TTTTTTTTTTAGCAGCTAGAAGG + Intergenic
935779932 2:106502121-106502143 TTGTATCTTTAGTAGAGAGAGGG - Intergenic
935798537 2:106669392-106669414 TTTCGTTTTGAGGAGCTAGATGG - Intergenic
936536447 2:113315163-113315185 TCTTTGCTTTAGGATCTAGATGG - Intergenic
936784108 2:116072525-116072547 TTGTATCTTTAGGAGATACAGGG - Intergenic
936964244 2:118111759-118111781 TTTTATCTTGAGAAACTAGATGG + Intergenic
937182252 2:120007301-120007323 TTTTATTTTTAGTAGATACAGGG + Intergenic
937492855 2:122388056-122388078 TGTTATCTCTAGGAGCAATATGG - Intergenic
937583702 2:123520889-123520911 TTTTATTTTTAGTAGATACAGGG - Intergenic
938511564 2:131952221-131952243 TTTTATCTTTAGTAGAGACAGGG + Intergenic
938746947 2:134288502-134288524 TTTTTTTTTAAAGAGCTAGATGG - Intronic
939024919 2:137000828-137000850 TTTTATTTTTAGTAACTAGAAGG + Intronic
939208897 2:139145690-139145712 TTTTATTTTTAGGAGATACAGGG - Intergenic
940523261 2:154779166-154779188 TTTTATAGTTTAGAGCTAGATGG + Intronic
941078562 2:161033936-161033958 TTTTATCTTAGGGAGGTTGATGG - Intergenic
941133751 2:161687053-161687075 TTTTATTTTTAGGAGACACAGGG + Intronic
941810596 2:169752464-169752486 TTTTATTTTTAGTAGAGAGAGGG + Intronic
941824621 2:169880571-169880593 TTTTATGGTTGGGTGCTAGAAGG + Intronic
941866116 2:170336488-170336510 TTTTATCTTTCGGAGCTCTTTGG - Intronic
942363050 2:175192891-175192913 TTTTATATTTAGGATCATGAAGG - Intergenic
943405361 2:187476510-187476532 TTTTATCTTTTGTAGAGAGAGGG + Intronic
944556687 2:200894378-200894400 TGTTATTTTAAGAAGCTAGAAGG + Intronic
944812277 2:203339405-203339427 TTTTATTTTTAGGAGAAACAGGG - Intronic
945280858 2:208034178-208034200 TGTTATCTATAGGAGCAAGTGGG - Intergenic
946766102 2:223042434-223042456 TTGTATTTTTAGTAGCGAGAGGG + Intergenic
946980655 2:225210913-225210935 TTTTATCTATTGTAGCTATAAGG - Intergenic
947298111 2:228655866-228655888 ATTTATTTTTGGGAGCAAGATGG - Intergenic
948956621 2:241297873-241297895 TTTTATTTTTAGTAGAGAGAAGG - Intronic
1168988069 20:2067970-2067992 TTTTACCTTCAGGAGCTCTATGG + Intergenic
1169100533 20:2944212-2944234 TTTTATTTTTAGTAGATATAGGG + Intronic
1169332649 20:4728989-4729011 TTTGAGCTTTTGGATCTAGAGGG - Intergenic
1170638685 20:18132332-18132354 TTGTATTTTTAGCAGATAGAGGG - Intergenic
1172924481 20:38519566-38519588 TTTTATCTTCTGGTGCAAGAGGG - Intronic
1173296804 20:41766909-41766931 TCTTATCTTTGGAACCTAGAGGG + Intergenic
1174674297 20:52338399-52338421 TTTTATATTTATCAGCTAGTGGG + Intergenic
1175079424 20:56406711-56406733 TTCTATCTTTAGGAGAGACAGGG + Intergenic
1176675227 21:9771371-9771393 TTTTCTGTGTAGGAGCTTGAGGG + Intergenic
1176739917 21:10591989-10592011 TTGTATTTTTAGTAGCTATAGGG - Intronic
1177320838 21:19518237-19518259 TTTTATTTTTAGAAGATAAATGG - Intergenic
1177405191 21:20657990-20658012 TTTTATATTTAGGAGAGACAGGG - Intergenic
1177979913 21:27899703-27899725 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1179251657 21:39675717-39675739 GTTTGACTTTAGGAGCTGGAGGG + Intergenic
1181115080 22:20627319-20627341 TTTTATCTTTCCGACCCAGATGG + Intergenic
1182252408 22:29011581-29011603 TTTTATCTTTAGGTTCTGAATGG + Intronic
1183067070 22:35370609-35370631 TTTTTTCTTTTGGAGAAAGAAGG - Intergenic
1184121518 22:42453531-42453553 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1185201238 22:49506802-49506824 TTTTATTTTTAGTAGATACAGGG - Intronic
950804436 3:15586690-15586712 TTTTATGTTTAGAGGCAAGATGG + Intronic
951910309 3:27743389-27743411 TTGTATTTTTAGTAGCGAGAGGG + Intergenic
953059212 3:39413379-39413401 TTGTATCTTTTGGAGAGAGATGG - Intergenic
954154515 3:48678053-48678075 ATTTATCTTGAGCAGCTAGATGG - Intronic
954566067 3:51601184-51601206 TTTTATCTTTAGTAGAAAGGAGG + Intronic
955934578 3:64090451-64090473 TTATATCTTTATGATCTAGGTGG - Intergenic
956188953 3:66590045-66590067 TTTTGTCTTTTGTAGCAAGATGG - Intergenic
956330018 3:68096121-68096143 TTTAATCTCAAGGAGGTAGAGGG - Intronic
956415969 3:69029611-69029633 TTTTATTTTTAGGAGAGAGTAGG + Intronic
956419818 3:69075901-69075923 TTTTATTTTTAGTAGATACAGGG + Intronic
957138520 3:76321340-76321362 TTGTATTTTTAGGAGATACAGGG - Intronic
958565259 3:95801898-95801920 TTTTATCTTTTGGAGCTGCATGG + Intergenic
958989210 3:100822323-100822345 TTTTATTTTTAAGAGATAAATGG + Intronic
959845264 3:111025171-111025193 TTTTTTTTTTTGGAGATAGATGG + Intergenic
959912872 3:111783887-111783909 TGTTATCTTTAAGAACCAGATGG + Intronic
960080787 3:113537953-113537975 TTATATTTTTAGGAGATACAGGG + Intronic
960910274 3:122642821-122642843 TTGTACCTTTAGGAGATACAGGG - Intergenic
961244792 3:125441666-125441688 TTTTATTTTTAGTAGATACAGGG - Intergenic
962560288 3:136599356-136599378 TTTTATTTTTAGTAGATACAGGG - Intronic
963693025 3:148528905-148528927 TTTAATATTTAGGAGATAGCTGG + Intergenic
963905427 3:150770005-150770027 TTTTATCTTTAGTAGAGACAGGG + Intergenic
964022466 3:152030122-152030144 TCATATATTTGGGAGCTAGATGG + Intergenic
964774679 3:160262706-160262728 TTTTGTCTTTAGGAGGAAAAGGG + Intronic
965071604 3:163922863-163922885 TTTTTTTTTTTGGAGTTAGAAGG + Intergenic
965370675 3:167858070-167858092 TTTTATTTTGAGGTGCCAGAAGG - Intergenic
965744672 3:171912453-171912475 TTTTATCTTTAGTAGAGATAGGG - Intronic
966421305 3:179737126-179737148 TCTTCTCTTTAGCAGCTAGTAGG + Intronic
967041571 3:185698218-185698240 TTTTACATTTAGGAATTAGAGGG - Intronic
967136439 3:186516535-186516557 TTTTATTTTTAGTAGAGAGAGGG + Intergenic
967336745 3:188352534-188352556 TTGAATGTTTAGGAGCAAGAAGG + Intronic
967875115 3:194263430-194263452 ATTAATATATAGGAGCTAGAAGG + Intergenic
968153058 3:196354387-196354409 TTTTATCAAGAGAAGCTAGAAGG + Exonic
968343357 3:197978816-197978838 TTGTATCTTTAGTAGACAGAAGG - Intronic
969076751 4:4585275-4585297 TTTGATTTTTAGTAGATAGATGG + Intergenic
969399837 4:6947187-6947209 TTTTATTTTTAGTAGCGACAGGG - Intronic
970023078 4:11590958-11590980 CATCATCTTTGGGAGCTAGAGGG + Intergenic
970393283 4:15638793-15638815 TTTTATCTTTTTGAGATATATGG - Intronic
971790670 4:31166645-31166667 TTTTATCTTTAGTAGAGACAGGG + Intergenic
971977898 4:33714364-33714386 TTTTATTTTTAGTAGATACAGGG - Intergenic
971982268 4:33767577-33767599 TTTTATTTTTAGTAGATACAGGG - Intergenic
972067499 4:34968191-34968213 TTTTATCTTCAGGTTGTAGAGGG + Intergenic
972476666 4:39457025-39457047 TTTTATCTTGAGGGGAGAGACGG + Intronic
972517458 4:39821575-39821597 TTTTATCTTTAGTAGAGACAGGG + Intergenic
974275025 4:59708332-59708354 TTTTGTCTTAAGAAGCAAGAAGG + Intergenic
974287419 4:59886732-59886754 TTGTATTTTTAGGAGCGACAGGG + Intergenic
974408770 4:61511183-61511205 TTGTATCTTTAGTAGAGAGAGGG - Intronic
974591847 4:63960326-63960348 TTTTATTTTTATGTGATAGAAGG - Intergenic
976884972 4:89970831-89970853 TTTTATCTTTAAGAGCTTTTTGG - Intergenic
978310489 4:107381043-107381065 TTTACTCTTTAGAATCTAGAGGG + Intergenic
978605480 4:110475102-110475124 TTGTATCTTTAGGAGAGACAGGG + Intronic
979666006 4:123311744-123311766 TTATATCATTAGGGCCTAGAAGG - Intronic
980033411 4:127856449-127856471 TTTTATCTTTAGTTTCTATATGG + Intergenic
980397494 4:132233233-132233255 TCTTATCTTTTGGAGTCAGAAGG - Intergenic
980966387 4:139525189-139525211 TTTTAGTCTAAGGAGCTAGATGG - Intronic
981072067 4:140553032-140553054 TTCTATTTTTAGGAGCTACTTGG + Exonic
981435991 4:144722678-144722700 TTGTATTTTTAGTAGATAGAGGG - Intronic
982237037 4:153261247-153261269 TTGTATTTTTAGTAGCGAGAGGG - Intronic
982520314 4:156408327-156408349 TTTTATTTTTAGTAGATACAGGG + Intergenic
984900723 4:184584115-184584137 TTTTGTCTTCAGGAACTAAAAGG - Intergenic
985400326 4:189587326-189587348 TTTTCTGTGTAGGAGCTTGAGGG - Intergenic
986417004 5:7539033-7539055 TTTTATCTTTAGTAGAGACAGGG + Intronic
987377124 5:17246305-17246327 TTTTATCTTTAGTAGAGACAGGG - Intronic
987489072 5:18554011-18554033 TGTTATCTTTGGGAGCTATTGGG + Intergenic
987495399 5:18636993-18637015 TTTTATTTTTAGTAGCTATGGGG + Intergenic
987902749 5:24034496-24034518 TTTTATATTTAAAAGCTAGTAGG - Intronic
987936856 5:24478283-24478305 TTTTTTCTTAAGGAGGGAGAGGG + Intergenic
989389763 5:40887815-40887837 TTTTATCTTTTTGCACTAGAAGG + Intergenic
990314425 5:54570719-54570741 TTTAATGCTTAGGAGCTATAGGG - Intergenic
990836933 5:60031960-60031982 TATTATCTTAAGAAGCTATAAGG + Intronic
991276397 5:64852643-64852665 TTGTATCTTTAGGAGAGATAGGG + Intronic
992393427 5:76350213-76350235 TTTTTTCTCTAGCAGCTAAAGGG - Intronic
992724467 5:79592244-79592266 TTGTATCTTTAGTAGATATAGGG + Intergenic
993641971 5:90416648-90416670 TTTTATTTTTAGGAGAGACAGGG + Intergenic
993653911 5:90555236-90555258 TTTTATCTTTAGATTCTAGGTGG + Intronic
994097971 5:95864299-95864321 TTTTATTTTTAAGACCTAGTAGG - Intergenic
994678484 5:102855871-102855893 TTTTATTTTTAGGAGGAAGTTGG - Intronic
995626512 5:114083307-114083329 TTCTATCTTAAAAAGCTAGAAGG - Intergenic
995823393 5:116264707-116264729 TTTTTTCTTTAGGAGCTTGATGG + Intronic
996785936 5:127236688-127236710 TTTTATCTTAAAGAGTGAGATGG - Intergenic
997149375 5:131476425-131476447 TTTTATTTTTAGTAGCGACAGGG - Intronic
997152916 5:131518566-131518588 TTTTATTTTTAGTAGAGAGAGGG + Intronic
997999786 5:138615871-138615893 TTTTATTTTTAGTAGAGAGAAGG - Intronic
998195763 5:140069242-140069264 TATTATCTTTGAGAGATAGATGG + Intergenic
998973651 5:147620285-147620307 TTTTATTTTTTGGAGATACAAGG + Intronic
999278883 5:150351317-150351339 TTTTATTTCTCAGAGCTAGAAGG - Intergenic
1000023688 5:157340673-157340695 TTTTAGCTTTGGAAGCCAGACGG - Intronic
1000260619 5:159585104-159585126 TTTTATCTTTCTGAGCTTCAAGG - Intergenic
1000309025 5:160023463-160023485 TTTTATTTTTAGGAGAGACACGG + Intronic
1000413411 5:160958168-160958190 TTTTAGTTTTAGCAGCTAGAAGG - Intergenic
1000543297 5:162567597-162567619 TTAGATCTTTTGGAGCCAGAGGG + Intergenic
1003707344 6:8547467-8547489 TTTCATTTTTAGGATATAGAAGG + Intergenic
1003804145 6:9706470-9706492 TTTTATTTTTAGGAGAGACAGGG + Intronic
1004470459 6:15924346-15924368 TTTTATTTTTAGTAGATACAGGG + Intergenic
1004722488 6:18279097-18279119 TATTATCTCTAGGAACTAGAAGG + Intergenic
1005297885 6:24444676-24444698 TTTTATTTTTTGTAGCGAGAGGG - Intronic
1005562325 6:27053546-27053568 TTTTTTTTTTTGGAGCTTGAGGG - Intergenic
1006469012 6:34215718-34215740 TTGTATTTTTAGGAGATACAGGG + Intergenic
1006766039 6:36508106-36508128 TTTTATTTTTTGGAGATACAAGG + Intronic
1007539424 6:42627319-42627341 TGTTATCTGTAGGAGCAAGTGGG + Intronic
1007855497 6:44851650-44851672 TTTTGTTTTAAGGAACTAGAAGG - Intronic
1007876358 6:45106706-45106728 TTTTATTTTTAGTAGATACAGGG + Intronic
1008673084 6:53793764-53793786 TTTTAGCTATAGCAGCTGGAGGG + Intergenic
1008721877 6:54364022-54364044 TTTTATCTTTAGGAGCTAGAAGG + Intronic
1008856292 6:56091934-56091956 TTTTATCTTGGGCAGCTAGGTGG - Intronic
1009243877 6:61210355-61210377 TTTTATCTTAAAGGTCTAGAGGG - Intergenic
1009422111 6:63474747-63474769 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1013358593 6:109371420-109371442 TTTTATTTTTAGGAGAGACAGGG + Intronic
1013466274 6:110419531-110419553 TTTTATCTGTAGGAACAAGTTGG - Intergenic
1013809094 6:114024613-114024635 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1015544666 6:134349134-134349156 TTTTATCTTTAGTAGAGATAAGG - Intergenic
1015984984 6:138875754-138875776 TTTTATTTTTAAGATCCAGAAGG - Intronic
1016527017 6:145013052-145013074 TTTTATGTGTAGGAGCTGAATGG + Intergenic
1017791988 6:157808279-157808301 TTATTTCTATAGGAGCTATATGG - Intronic
1017969889 6:159303243-159303265 TTTTCTCTTTTGGAGTTAGGAGG + Intergenic
1018296992 6:162358885-162358907 TTTTATTTTTAGTAGATAGGAGG - Intronic
1018310259 6:162501197-162501219 ATTTATCTTTTGGAGCTTGGGGG - Intronic
1020379341 7:7526014-7526036 TTGTATCTTTAAGAGCTAGGAGG + Intronic
1021731664 7:23601209-23601231 TTTTATTTTTAGCAGCGACAAGG - Intronic
1022077027 7:26981894-26981916 TTTTATTTTTAGTAGAGAGAGGG - Intronic
1023683548 7:42713171-42713193 TTGTCTCTCTAGGAGCCAGATGG + Intergenic
1023974371 7:45016941-45016963 TTGTATTTTTAGGAGCGACAGGG + Intronic
1024090127 7:45930945-45930967 TTTTATGTTTTGGAGCTATTTGG + Intergenic
1024280385 7:47713883-47713905 TTTCAGCTTTAGGAGCCACATGG - Intronic
1024289041 7:47787021-47787043 TTGTATCTTTATAAACTAGAAGG - Intronic
1025636169 7:63321393-63321415 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1025646527 7:63426783-63426805 TTTTATCTTTAGTAGAGACAGGG + Intergenic
1025898848 7:65727626-65727648 TTGTATTTTTAGTAGCGAGAGGG - Intergenic
1026365183 7:69641292-69641314 TTTTGTCTGGAGGATCTAGAGGG - Intronic
1027670067 7:81085508-81085530 TTTTATCTTCAGTATGTAGATGG + Intergenic
1028483818 7:91336724-91336746 TATTCTCTTTAGGATTTAGATGG - Intergenic
1029102477 7:98143782-98143804 ATTTATCTTTAGGAACTAATTGG + Intronic
1029953242 7:104609090-104609112 TTTTATTTTTAGTAGATACAGGG - Intronic
1030087220 7:105826909-105826931 TTTTACCTTTGGGATATAGAAGG + Intronic
1030472428 7:109982062-109982084 TTTTATCTATAGGAGCAATTGGG - Intergenic
1030837542 7:114308161-114308183 TTTTATCTTAAAGGGCAAGATGG + Intronic
1032420231 7:131773059-131773081 TTTTATTTTTAGTAGATATAGGG - Intergenic
1032969761 7:137147421-137147443 TTTTCTATTTTGGAGCTAGCTGG - Intergenic
1033599431 7:142877986-142878008 CATTATCTTTGGCAGCTAGAAGG + Exonic
1034925103 7:155114835-155114857 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1035823973 8:2624738-2624760 TTTGGTCATTAGAAGCTAGAAGG + Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1036779550 8:11636045-11636067 TTGTATTTTTAGTAGATAGAGGG - Intergenic
1036834554 8:12050605-12050627 TTGTATCTTTAGTAGCAATAGGG + Intergenic
1036856398 8:12297169-12297191 TTGTATCTTTAGTAGCAATAGGG + Intergenic
1037505722 8:19527435-19527457 TTCTATTTTTAGGAGTTGGAGGG - Intronic
1037982905 8:23267715-23267737 TTGTATCTTTAGTAGCGATAGGG - Intergenic
1038766956 8:30437616-30437638 TTTTATTTTTAGTAGCGACAGGG - Intronic
1039095933 8:33885431-33885453 TTTTTTCTTTAGGAGAGAGAGGG + Intergenic
1039575057 8:38616398-38616420 TTGTTTCCTTAGGAGCTGGAAGG + Intergenic
1039938564 8:42069132-42069154 TTGTATCTTTAGGAGAGACAGGG - Intergenic
1040894155 8:52348570-52348592 TTGTATTTTTAGTAGATAGAGGG - Intronic
1042283939 8:67086894-67086916 TTTTTTTTTTACGATCTAGAAGG + Intronic
1042426760 8:68658008-68658030 TTTTTTCTTTATGAGCAAGAAGG + Intronic
1042794688 8:72648448-72648470 TTTTATTTTTAGTAGATACAGGG + Intronic
1042856010 8:73268303-73268325 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1043467563 8:80527347-80527369 TTGTATTTTTAGTAGCTACAGGG + Intergenic
1043560857 8:81491579-81491601 TTGTATCTTTAGTAGATACAGGG + Intergenic
1043910393 8:85857400-85857422 TTTTATTTTTAGGGGGTGGAAGG - Intergenic
1045577306 8:103438575-103438597 ATTTATCTTTAGTAGCTATGGGG + Intronic
1045685497 8:104707173-104707195 TTTTATCTTAAGGAAGAAGAGGG + Intronic
1046790699 8:118318823-118318845 ATGTGTCTTTAGGAGCTTGAGGG + Intronic
1047039250 8:120974419-120974441 TTTTATTTTTAGTACCTACAGGG - Intergenic
1048073579 8:131043998-131044020 TTGTATTTTTAGGAGATAGGGGG - Intergenic
1048578425 8:135710897-135710919 TTTTATTTTTAGTAGAGAGAGGG + Intergenic
1049049663 8:140184619-140184641 TTTTATTTTTAGTAGATACAGGG + Intronic
1049153295 8:141050284-141050306 TTTTTTTTTTTGGAGCGAGATGG - Intergenic
1050718191 9:8554012-8554034 TTGTATCTTTAGTAGAGAGAGGG - Intronic
1051362632 9:16294634-16294656 TTTTTTCTTTCGCAGCTGGAAGG + Intergenic
1051890174 9:21933190-21933212 TTTTTTCTTTTGAAGCTGGATGG + Intronic
1052054473 9:23888018-23888040 CTTTATCTTTAGTAGCTATAGGG - Intergenic
1052578931 9:30329116-30329138 TTTTGACTTTGTGAGCTAGAAGG - Intergenic
1052675897 9:31622862-31622884 TTTTATATTTATGAGCTAGAGGG + Intergenic
1055118753 9:72634305-72634327 TTTTATCTATAGGAGCAAGAGGG + Intronic
1055308697 9:74955604-74955626 TTTTATTTTTAGTAGCAACAAGG + Intergenic
1055679363 9:78699159-78699181 TTGTATCTTTAGTAGCGACAGGG + Intergenic
1055698277 9:78912747-78912769 TGTTGTCTTTAAAAGCTAGAAGG + Intergenic
1055740048 9:79378065-79378087 TCACATCTTTGGGAGCTAGAAGG - Intergenic
1056328409 9:85501469-85501491 TTTTCTGTTTTGCAGCTAGATGG - Intergenic
1057348004 9:94269054-94269076 TTTTTTTTTTAGGAGCTCAATGG - Intronic
1057634821 9:96754875-96754897 TTCTATCTTTATTAGCTTGAAGG + Intergenic
1057846840 9:98532456-98532478 TTTTATCATTAGGAGACAGAGGG - Intronic
1057909903 9:99010961-99010983 TTTTATCTTAAAGATCTAAAAGG - Intronic
1058660748 9:107266338-107266360 TTGTATCTTTAGTAGATACAGGG + Intergenic
1060130476 9:121092979-121093001 TTTTATCTTTAGTAGAGACAGGG + Intronic
1061233237 9:129327099-129327121 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1186027564 X:5329802-5329824 TTTTATCTGTAGGAGCTACTGGG - Intergenic
1186889555 X:13947000-13947022 TTTTACCTTGGGGAGCCAGAGGG + Intergenic
1188700620 X:33257212-33257234 TTTTATGTTTAGAATATAGAAGG - Intronic
1190335475 X:49259186-49259208 TTTTAGCTTGAGCAGCTGGAAGG + Intronic
1190867194 X:54394734-54394756 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1190867472 X:54396981-54397003 TTTTATCTTTAGTAGAGACAGGG + Intergenic
1190903889 X:54706914-54706936 TTTTATCTCTCAGAGCTATAAGG + Intergenic
1193247783 X:79249909-79249931 TTTTATCTTTAGTAGAGACAGGG - Intergenic
1193427509 X:81357231-81357253 TTATGTCTTTTGGAGCTGGAAGG + Intergenic
1194219053 X:91168602-91168624 TTTTAGTCTTAGGAGCAAGATGG - Intergenic
1194280945 X:91953490-91953512 TTTTATATTTAGAAGCAAGTTGG + Intronic
1195523557 X:105858975-105858997 TGTTATTTTTTGGAGCTAGCTGG + Intronic
1196255735 X:113516077-113516099 TTTTCTCTTAAGGACATAGAAGG - Intergenic
1196821387 X:119703862-119703884 TTTTATTTTTAGTAGCGACAGGG + Intergenic
1197339098 X:125244007-125244029 TTTTATCTTTAGTAGACACATGG - Intergenic
1197424211 X:126274801-126274823 TTTTAGTTTTAGTAGCTAGGGGG + Intergenic
1197926262 X:131649738-131649760 TTTAATTTTTAGTAGCTACAAGG + Intergenic
1198208112 X:134488308-134488330 TTTTATCTTTAGTAGAGACAGGG + Intronic
1199235257 X:145485364-145485386 TTTTGTCCTGAGGAGCCAGAAGG + Intergenic
1199339917 X:146665363-146665385 TTTTATCTTTTTGAGCTGCATGG - Intergenic
1200555566 Y:4632358-4632380 TTTTAGTCTTAGGAGCAAGATGG - Intergenic
1200598537 Y:5178150-5178172 TTTTATATTTAGAAGCAAGTTGG + Intronic
1200987441 Y:9318115-9318137 TTGTATCTTTAGGAGAGACAGGG + Intergenic
1201618524 Y:15928672-15928694 TTGTATCTTTAGTAGATATAGGG + Intergenic
1201920634 Y:19229933-19229955 TTGTATCTTTAGTAGATACAGGG + Intergenic
1202118148 Y:21494558-21494580 TTGTATCTTTAGGAGAGACAGGG - Intergenic
1202120599 Y:21518098-21518120 TTGTATCTTTAGGAGAGACAGGG - Intronic
1202123050 Y:21541639-21541661 TTGTATCTTTAGGAGAGACAGGG - Intronic
1202155955 Y:21887742-21887764 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202158403 Y:21911283-21911305 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202184858 Y:22176208-22176230 TTGTATCTTTAGGAGAGACAGGG + Intronic
1202206502 Y:22410193-22410215 TTGTATCTTTAGGAGAGACAGGG - Intronic