ID: 1008723528

View in Genome Browser
Species Human (GRCh38)
Location 6:54388557-54388579
Sequence CCTCCCATTTACCCTACCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 248}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008723528_1008723531 -2 Left 1008723528 6:54388557-54388579 CCCAGGGTAGGGTAAATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 248
Right 1008723531 6:54388578-54388600 GGCGAGTGTGAGAGCTGTTGAGG 0: 1
1: 0
2: 0
3: 9
4: 200
1008723528_1008723533 19 Left 1008723528 6:54388557-54388579 CCCAGGGTAGGGTAAATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 248
Right 1008723533 6:54388599-54388621 GGTGAAGCTGCTAATTTATTGGG No data
1008723528_1008723532 18 Left 1008723528 6:54388557-54388579 CCCAGGGTAGGGTAAATGGGAGG 0: 1
1: 0
2: 0
3: 13
4: 248
Right 1008723532 6:54388598-54388620 AGGTGAAGCTGCTAATTTATTGG 0: 1
1: 0
2: 1
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008723528 Original CRISPR CCTCCCATTTACCCTACCCT GGG (reversed) Intronic
900465025 1:2821400-2821422 CCACCCATGAACCCTTCCCTGGG - Intergenic
900762344 1:4481745-4481767 CCTCCCGTTAGACCTACCCTTGG - Intergenic
900802883 1:4748198-4748220 CCTCCCATTGACCCTCACCCTGG + Intronic
901163671 1:7199306-7199328 GCTCCCTTTTACCCTCCGCTTGG - Intronic
902118846 1:14144349-14144371 CATCCCAGGTACCCTTCCCTAGG - Intergenic
903866456 1:26402124-26402146 ACTCCCATTCACCCTTTCCTGGG + Intergenic
904490257 1:30854223-30854245 CGTCCCTTTTCCCCTACCATTGG - Intergenic
905266254 1:36756200-36756222 CCTCCCATTTGCCCCACACTAGG + Intergenic
906090247 1:43172560-43172582 CCTCCCCTTTCCCCTCCCCCGGG - Exonic
906381155 1:45332884-45332906 GTTCCTATTTCCCCTACCCTAGG + Intronic
909520150 1:76558592-76558614 CCTCCCATTCTCCCTACTCTAGG - Intronic
910284647 1:85540285-85540307 CCTTACATTTACCCAGCCCTGGG + Intronic
912324848 1:108747420-108747442 CCTTCCGTTTTCCCTACTCTCGG + Intronic
912342269 1:108928381-108928403 CCTCCAATTAACCCAACACTTGG - Intronic
912453790 1:109784516-109784538 CCTCCCATTTCCTCTATCCCGGG + Intergenic
913262155 1:117008885-117008907 CTTCCCTTTTACAGTACCCTGGG + Intronic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
914921572 1:151851036-151851058 CCTACCAGTGACCTTACCCTGGG + Exonic
915091543 1:153429608-153429630 TCTCCCATTTACCCTCCTCTAGG - Intergenic
918875303 1:190033635-190033657 CCTCCCAATTACCATACATTAGG + Intergenic
919739937 1:200975313-200975335 CCTCCCTTCTTCCCTACCCGCGG - Intronic
919899324 1:202032372-202032394 CCTCCCATCTCGCCTACCCAAGG + Intergenic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
921757725 1:218879560-218879582 CCTGCCAGTTTCCCTACCCCTGG + Intergenic
922190776 1:223316655-223316677 CCTCCCTTTTGCCCTCCACTGGG - Intronic
924864216 1:247960361-247960383 CCTCCCATTTAGGCTACTCAGGG + Intronic
1062842658 10:683109-683131 CCTCTCATTTTCCCTTCGCTGGG - Intronic
1066139325 10:32487906-32487928 CCTCCCATTTAGGCTACTCAGGG + Intronic
1066158574 10:32704430-32704452 CCTCCCATTTAGGCTACTCAGGG + Intronic
1066785105 10:38995032-38995054 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1067339340 10:45388410-45388432 CCTCCCAGTTAGGCTACTCTGGG - Intronic
1068085157 10:52365607-52365629 CCTCCCAGTTAGGCTGCCCTGGG + Intergenic
1068210152 10:53910219-53910241 CCTCCCAGTTAGGCTACACTGGG - Intronic
1070140409 10:73733922-73733944 CCTCCCAGTTCCCCCACCCCAGG + Intergenic
1070421140 10:76238480-76238502 CCTCCCATCTTCTCTACCCAGGG + Intronic
1071265401 10:83960290-83960312 CCTTCCATCTCCCATACCCTGGG + Intergenic
1072605070 10:96974322-96974344 CCTCCCATTAACCAATCCCTAGG + Intronic
1073482300 10:103794173-103794195 CCACCCATGCACCCCACCCTGGG - Intronic
1073957430 10:108889569-108889591 CCTCCCCTTTCTCTTACCCTTGG - Intergenic
1075018098 10:118925883-118925905 CCTCCCTATTATCCTACTCTAGG + Intergenic
1075468639 10:122671302-122671324 CCCCTCATTCACCCTACCCCTGG - Intergenic
1075535870 10:123271666-123271688 CCTCCTATTCTCCCTATCCTCGG - Intergenic
1076580861 10:131509983-131510005 CCTCCCAGTTAGGCTACCCGGGG + Intergenic
1079791986 11:24749726-24749748 CCTCCCATTTCTCCTGCCCTTGG + Intronic
1079888814 11:26024534-26024556 TTGCCCATTTCCCCTACCCTGGG + Intergenic
1081850283 11:46270878-46270900 CCTCCCATTGGCCCTAACCCAGG - Intergenic
1083044100 11:59716832-59716854 CTTCCCTTCTACCCTACCCCAGG + Intronic
1083494737 11:63041707-63041729 CCTCCCATTTAGGCTACTCGGGG + Intergenic
1084497537 11:69513680-69513702 CCTCCCTTTTTCCCTCCCCATGG + Intergenic
1085052299 11:73386167-73386189 CCTCCCATGTCTCCTAGCCTGGG - Intronic
1087249090 11:95876021-95876043 CCTCCCAGTTAGGCTACTCTGGG + Intronic
1089455224 11:118621893-118621915 CCTCCCATATTCCCTTCACTCGG + Intronic
1090048439 11:123357097-123357119 CCTCCCAAATGCCCTTCCCTCGG - Intergenic
1091211077 11:133861970-133861992 CTCCCCATTCTCCCTACCCTCGG + Intergenic
1091393481 12:139758-139780 CCTCGCATTTCACCAACCCTGGG - Intronic
1091641214 12:2239135-2239157 CCTCCCTTTTGCCCTGCCCACGG - Intronic
1093136396 12:15457089-15457111 CCTTCCATTTCTCCTGCCCTTGG + Intronic
1096490328 12:52009471-52009493 CCTGCCAGTTACCCCTCCCTGGG + Intronic
1097194883 12:57237804-57237826 CCCCACCTTTACCCTACCCCAGG - Intronic
1097294041 12:57943866-57943888 CCTCCCAGCCACCCTGCCCTTGG - Intronic
1098586068 12:72155813-72155835 CCTCCCAGTTAGGCTACTCTGGG + Intronic
1099532057 12:83795130-83795152 CCTTCAATTTCCCCTGCCCTTGG - Intergenic
1102998642 12:117368375-117368397 CCTCCCCATTATCCTCCCCTAGG - Intronic
1104809295 12:131610899-131610921 CCTCACTTTTACCCTCCCCTGGG - Intergenic
1106040606 13:26087336-26087358 CCTCCTTTTCACCCTATCCTAGG - Intergenic
1107102960 13:36613846-36613868 GCTTCCATTTATCCTTCCCTGGG + Intergenic
1108709367 13:53017628-53017650 TCTCCCTTTACCCCTACCCTGGG + Intergenic
1109860458 13:68191164-68191186 CCTCCCATTCTTCCTGCCCTTGG + Intergenic
1110356727 13:74575741-74575763 TCTCCAATTTTCCCTGCCCTTGG - Intergenic
1112311965 13:98326456-98326478 CTTCCCATTTCCCCCTCCCTTGG + Intronic
1113117685 13:106890947-106890969 TCTCCCATTTCCCCTTGCCTTGG - Intergenic
1113424187 13:110194345-110194367 CCTCCTATTTGTCCTACTCTCGG + Intronic
1116919919 14:50561076-50561098 CCTCTCCTTTCCCCTCCCCTCGG - Intronic
1117193771 14:53318746-53318768 CCTCCCAGTTAGGCTACCCAGGG - Intergenic
1117528982 14:56640215-56640237 CCTCCCATTTAGGCTACTCGGGG - Intronic
1117807940 14:59513886-59513908 CCTCCCAGTTACGCTACTCGGGG - Intronic
1119542127 14:75446645-75446667 CCTCCCATCTCCCCACCCCTAGG - Intronic
1120882979 14:89428915-89428937 CCTCCCATTGAACCTGGCCTGGG - Intronic
1124414833 15:29466469-29466491 CCTCCCCTGGACCCTCCCCTGGG - Intronic
1124414880 15:29466604-29466626 CCTCCCCTGGGCCCTACCCTGGG - Intronic
1124415006 15:29466909-29466931 CCTCCCCTGGGCCCTACCCTGGG - Intronic
1125499448 15:40230056-40230078 CCTCCCATGTGCCTTGCCCTGGG - Intergenic
1126979907 15:54228814-54228836 CCACCCATTTCCCCAACCCCAGG - Intronic
1127627987 15:60799066-60799088 CCTTCCCTTTAACCTACCCCAGG + Intronic
1128633663 15:69289065-69289087 CTTCCCATTTACCCTACTTCCGG - Intergenic
1129408650 15:75336658-75336680 CCTCCGATTTCCCCTTCCCTTGG - Intronic
1131885704 15:96910260-96910282 CCTCCCATTTTCCCTTACTTGGG - Intergenic
1132218354 15:100084563-100084585 CCTCCCATTTAGGCTACTCGGGG - Intronic
1133938893 16:10292128-10292150 CCTCCCAGTTAGGCTACTCTAGG + Intergenic
1134290975 16:12902636-12902658 CCTCCCCTTCGCCCTCCCCTCGG + Intronic
1135426671 16:22343069-22343091 CTTCCCATTTCCCCCACCCCTGG - Intergenic
1136606628 16:31338589-31338611 CCTCCCATTTAGGCTACTCGGGG - Intergenic
1137252959 16:46753216-46753238 CTCCCCATTTACCCTACCGGGGG - Intronic
1137611445 16:49820992-49821014 CCACGCATTTTCCCAACCCTTGG + Intronic
1138360309 16:56422675-56422697 CCTTCCATGAACCCTTCCCTGGG + Intronic
1138417590 16:56880069-56880091 CCTGCCACTTCCCCTCCCCTGGG - Intronic
1139971995 16:70782058-70782080 CCTCCCATTGACCATACACGTGG + Intronic
1140266956 16:73429154-73429176 TCTCCCAATCACCCTACTCTGGG + Intergenic
1141946106 16:87311078-87311100 CCTCCCATCTCCCCTTCCCCCGG + Intronic
1145396714 17:22502359-22502381 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1146067237 17:29645819-29645841 CCTCCCATTTACTCAACATTTGG - Intronic
1146547121 17:33749236-33749258 CCTCCCTTTCCCCCTACCCCAGG + Intronic
1147133292 17:38421124-38421146 GCTCCCCTGTACCCTCCCCTGGG + Intergenic
1148129254 17:45253229-45253251 CCTCCCATTCTCCCTCCCCCAGG + Intergenic
1148508734 17:48149621-48149643 CCTGCTTTTCACCCTACCCTCGG + Intronic
1148653770 17:49268238-49268260 TCTCCCCTTCACCCTTCCCTAGG + Intergenic
1148804264 17:50256411-50256433 TCTCCCATCCACCCTACCCCTGG + Intergenic
1150833213 17:68541768-68541790 CCTTCCATATACCCAACACTAGG - Intronic
1153168233 18:2285938-2285960 CCTCCCATCTACCATATTCTAGG - Intergenic
1153301361 18:3594770-3594792 ACTGCCATCCACCCTACCCTTGG - Intronic
1156744504 18:40372486-40372508 CCTCCCATTCTCCCTTTCCTGGG + Intergenic
1157232021 18:45926312-45926334 CCTCCCACTCACCCCACCCCCGG - Intronic
1159007626 18:63026528-63026550 CCTCCCATATACCATCACCTGGG - Intergenic
1161307661 19:3576837-3576859 CCTCCCCTTTCCCCTACCTCCGG - Intronic
1164827202 19:31292534-31292556 CCATCCATTTACCTTCCCCTTGG - Intronic
1165261889 19:34625839-34625861 CCTCCCATTTAGGCTACTCGGGG - Intronic
1165585164 19:36908696-36908718 CCTCCCATTTTCCCCTCTCTTGG - Intronic
1166929409 19:46292817-46292839 CCTGCCATTTACTCCAGCCTGGG - Intergenic
1167433209 19:49464898-49464920 CCTCACACTTTCCCTACCCCAGG + Intronic
925013819 2:506645-506667 CCTCCAATTTTCCGTCCCCTTGG + Intergenic
927041365 2:19233989-19234011 CCTCCCACTTGCCTTACCCTAGG + Intergenic
927089258 2:19698133-19698155 CTTTCCATTTACCATTCCCTAGG - Intergenic
928759103 2:34560732-34560754 CCTCCCATTTAGGCTACTCTGGG + Intergenic
929592349 2:43155465-43155487 CCTCCCATTAGCCCTCCCTTCGG + Intergenic
932231228 2:70086293-70086315 CCTCCCCTGTTCCTTACCCTTGG - Intergenic
932921646 2:75921540-75921562 CCTCCCCTTTTCCCTTCCCCAGG - Intergenic
933593932 2:84263075-84263097 CCTCCCAGTTAGGCTACTCTGGG - Intergenic
933801607 2:85964502-85964524 CCTCCCATTTAGGCTACTCAGGG - Intergenic
933840926 2:86284951-86284973 CATCCCATTTCCCCTTCCCCAGG - Intronic
935211563 2:100943462-100943484 CCTCTCATTCATCCCACCCTAGG + Intronic
935708819 2:105879684-105879706 CCTCCCACTGCCACTACCCTGGG - Intronic
935891977 2:107688615-107688637 CCTGCCAGTCACCCTTCCCTGGG + Intergenic
936152177 2:110027874-110027896 CCACCCAGTTCCCCTGCCCTCGG - Intergenic
936192501 2:110343539-110343561 CCACCCAGTTCCCCTGCCCTCGG + Intergenic
936697690 2:114970019-114970041 CCCACCCTTTATCCTACCCTAGG + Intronic
937338181 2:121074790-121074812 CCTCCCTTTTGCCCTCCCCAGGG - Intergenic
938799867 2:134751938-134751960 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
939479302 2:142728568-142728590 CCTCCCAGTTAGGCTACTCTGGG - Intergenic
943004201 2:182369804-182369826 CCTTCCATTTGCACTACACTTGG - Intronic
943155476 2:184169594-184169616 CCTTCCATTCCCCCTGCCCTTGG + Intergenic
945321791 2:208432775-208432797 CCATCCATTTATCCTATCCTTGG - Intronic
945811934 2:214559384-214559406 CCTCCCACTGACTCTACCCTGGG + Intronic
945975236 2:216265281-216265303 CCTACAATGTACCCAACCCTGGG + Intronic
946488674 2:220126277-220126299 CTTCCCTTTTCCCCTTCCCTGGG - Intergenic
947604222 2:231473631-231473653 CCTCCCATCTCCCCAGCCCTTGG - Intronic
1168858468 20:1027801-1027823 CCTCCCATATACCGTGCCCACGG + Intergenic
1170719776 20:18866633-18866655 CCTCCCAGTTACGCTACTCGGGG + Intergenic
1170756561 20:19211565-19211587 CCTCCCATTTCCCCCATTCTAGG - Intergenic
1172939835 20:38646460-38646482 ACTCCCATTTTCCCAACCCTCGG - Intronic
1173775512 20:45703042-45703064 TCTCCAATTAACTCTACCCTGGG - Intronic
1174119949 20:48257183-48257205 CTTCCCATACACCCTACACTAGG - Intergenic
1175542430 20:59756105-59756127 CCTCCCTTCTCCCCTATCCTTGG - Intronic
1178876907 21:36420772-36420794 CCTCCCTGTCACCCTCCCCTTGG + Intergenic
1178905627 21:36633504-36633526 TCTCCCATTTATCCTACTCTAGG - Intergenic
1183277511 22:36908654-36908676 TCTCCTATTTACCTTGCCCTGGG - Intergenic
1183619699 22:38965286-38965308 ACTCACATCTAACCTACCCTGGG + Intronic
950928329 3:16765282-16765304 CCCCCCATTTTCCCAACCGTTGG - Intergenic
954468331 3:50671202-50671224 TCTTCCATTTACCTGACCCTGGG + Intergenic
955342082 3:58132748-58132770 CCTCACCTTTACTCCACCCTTGG - Intronic
957208337 3:77228587-77228609 CCTCCCCTTTCCCCAACCCTGGG - Intronic
957454417 3:80422462-80422484 CCTCACATTTTTCCTAGCCTCGG + Intergenic
957780760 3:84815190-84815212 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
957943831 3:87037652-87037674 ACTCACCTTTGCCCTACCCTGGG - Intergenic
961619584 3:128213111-128213133 CCTCCCACTCACCCTAGCCAAGG - Intronic
961956086 3:130805341-130805363 CCTCCCATTTAGGCTACTCGGGG - Intergenic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
962968771 3:140379575-140379597 CCTCCCATGTTCCCTTCCCCAGG - Intronic
965030323 3:163357152-163357174 CCTCCCATTTAGGCTACTCACGG + Intergenic
966115248 3:176453587-176453609 CCTCCCAGTTACGCTACTCGGGG + Intergenic
967856840 3:194124431-194124453 CTTCCCACGTACCTTACCCTGGG + Intergenic
968010615 3:195271586-195271608 CCTCCCTTTTCCCCCGCCCTGGG + Intergenic
968065546 3:195757090-195757112 ACTCCCATTTCCTCTCCCCTCGG + Intronic
968276337 3:197443244-197443266 CCACACATTCACCCTGCCCTTGG - Intergenic
971341902 4:25778111-25778133 CCTCCCATTCACCATACCTCAGG + Intronic
971618674 4:28827539-28827561 TCTCCCATTTACCCTCTCCGCGG - Intergenic
973986962 4:56363443-56363465 CCTCCCAGTTAGGCTACCCGGGG - Intronic
975256037 4:72236291-72236313 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
977776692 4:100929427-100929449 CCTTCCTTTTCCCCTGCCCTTGG - Intergenic
978004780 4:103602810-103602832 CCTCCCATTTAGGCTACTCGGGG + Intronic
978012802 4:103708221-103708243 CCTCCCATTTAGGCTACTCAGGG - Intronic
978859683 4:113433369-113433391 TCTCCCATTCACCATACACTAGG + Intergenic
981109151 4:140915766-140915788 CCTCCCATTTAGGCTACTCGGGG - Intronic
986577185 5:9224724-9224746 CCTGCCATTTACCGAAGCCTAGG - Exonic
989569552 5:42932436-42932458 CCTCCCACTTAGGCTACCCAGGG - Intergenic
990038299 5:51349377-51349399 CCTCCCAATTAGCCTACTCGGGG - Intergenic
992604372 5:78440630-78440652 CCTCCCAGTTAGGCTACTCTGGG + Intronic
992634115 5:78710456-78710478 CCTCCCATTTAGGCTACTCGGGG - Intronic
993107310 5:83613847-83613869 CCTTCCATCTCCCATACCCTTGG - Intergenic
994549806 5:101217970-101217992 CATCCCAATTACTCTAACCTTGG + Intergenic
999046784 5:148478326-148478348 CCTCCAAACTAACCTACCCTTGG - Intronic
1001441058 5:171743354-171743376 ACTCCCATTTACACTAACCATGG - Intergenic
1001636021 5:173211091-173211113 CCTCACCTTTGCCCTAGCCTTGG - Intergenic
1002065675 5:176650549-176650571 CCTCCCACTTGGCCTGCCCTTGG - Intronic
1003456079 6:6283787-6283809 CCTCCTGGTTGCCCTACCCTTGG + Intronic
1003529856 6:6928395-6928417 CCTAGCATTTTGCCTACCCTGGG - Intergenic
1004335091 6:14757195-14757217 CTTCCCTTTCACCCTACCCCAGG - Intergenic
1008723528 6:54388557-54388579 CCTCCCATTTACCCTACCCTGGG - Intronic
1009476380 6:64097173-64097195 CCTCCCAATTAGGCTACTCTGGG + Intronic
1009899635 6:69796346-69796368 TCCCTCATTTTCCCTACCCTTGG - Intronic
1010286540 6:74084463-74084485 CCTCCCATTTAGGCTACTCGGGG + Intergenic
1012753630 6:103193877-103193899 CCTCCAATATTGCCTACCCTTGG - Intergenic
1016641131 6:146350907-146350929 CTTCCCCTTTAACCTAGCCTGGG + Intronic
1019736071 7:2650254-2650276 CCACCCATTTGGCCTCCCCTGGG - Intronic
1026953855 7:74364551-74364573 CCCCCCATCTGCCCTGCCCTGGG - Intronic
1028436217 7:90807187-90807209 CCTCCCACTTACGCTACTCGGGG - Intronic
1029123717 7:98283952-98283974 CCTGCCACTTCCCCTTCCCTAGG + Intronic
1029608594 7:101614659-101614681 CCTCCCCTTCACCCCTCCCTCGG - Intronic
1032204881 7:129853887-129853909 CCTGCCATTTACCTTGCCCCAGG - Intronic
1033293407 7:140108692-140108714 TCTCCCATTTAGGCTACCCAGGG + Intronic
1034813420 7:154151730-154151752 CCTCCCGTCTCCCCTACCCCAGG + Intronic
1036745660 8:11407395-11407417 CCTCCCATTTAGGCTACTCGGGG + Intronic
1036954413 8:13171847-13171869 CCTCCAATTGACCCTCACCTGGG - Intronic
1038881952 8:31624566-31624588 ACTCCCATGTACCCTTCCTTGGG + Intergenic
1040363743 8:46692502-46692524 CCTCCCACTTACGCTACTCAGGG - Intergenic
1040827209 8:51636912-51636934 CCTCCCAGTTAGGCTACTCTGGG - Intronic
1041125994 8:54639091-54639113 TCTCCCCTTTGCCCAACCCTTGG + Intergenic
1042765929 8:72321731-72321753 CCTCCCATTTAGGCTACTCAGGG - Intergenic
1043182766 8:77106219-77106241 CCTCCCAGTTAGGCTACCCGGGG - Intergenic
1043408922 8:79971519-79971541 CCTCCCATCTTCCCATCCCTAGG + Intronic
1044402478 8:91788504-91788526 CCTCCCAGTTAGGCTACCCAGGG - Intergenic
1044811843 8:96071123-96071145 CCTCCCAGTTAGGCTACTCTGGG - Intergenic
1045177324 8:99739543-99739565 CCTCCCAGTTAGGCTACTCTGGG - Intronic
1046119789 8:109831523-109831545 CCTTCCATTTCTCCTGCCCTTGG + Intergenic
1049931472 9:461312-461334 CCTCTCATTTTCCATTCCCTTGG + Intronic
1053443617 9:38135462-38135484 CCTCCCATTCTCCTTTCCCTGGG + Intergenic
1056155640 9:83833311-83833333 GCTCCCCAGTACCCTACCCTTGG + Intergenic
1056285203 9:85080478-85080500 TTTCCCATTCACCCTCCCCTAGG - Intergenic
1056354895 9:85790255-85790277 GCTCCCCAGTACCCTACCCTTGG - Intergenic
1056416577 9:86382893-86382915 CCTCCCAGTTAGGCTACCCAGGG + Intergenic
1058517378 9:105790495-105790517 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1059443639 9:114324944-114324966 CCCCCCATTCACCCACCCCTGGG + Intronic
1059444839 9:114331721-114331743 CCCCCCATTCACCCACCCCTGGG + Intronic
1060323243 9:122585713-122585735 ACTCCCATTTACCTTCCCCGTGG - Intergenic
1060865614 9:126993749-126993771 CCTCCCAGTTAGGCTACTCTGGG - Intronic
1061486919 9:130924709-130924731 CCTCCAGTTTACTCTTCCCTGGG - Intronic
1062182736 9:135199358-135199380 TCTCCCAGTTACCCTCCCCAGGG - Intergenic
1062278381 9:135741188-135741210 CCTCCCATCTACTCTGCCCAAGG - Intronic
1186785812 X:12955182-12955204 CCTCCCATTCTCTCTCCCCTAGG + Intergenic
1189045569 X:37587217-37587239 CCTCCCAGTTAGCCTACTCAGGG + Intronic
1189930437 X:46003760-46003782 CCTCCCATTTAGGCTACTCAGGG + Intergenic
1190606668 X:52150555-52150577 CCTCCCAGTTACTCTACTCGGGG + Intergenic
1190811527 X:53889001-53889023 CCTCCCAGTTAGGCTACCCGGGG - Intergenic
1190877682 X:54471259-54471281 CCTCCTCTGTACCCTCCCCTGGG + Intronic
1191702940 X:64062909-64062931 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1191921188 X:66258754-66258776 CTTCCCATTTCCACTATCCTAGG - Intronic
1192333543 X:70199466-70199488 CTTCCCCTCTCCCCTACCCTTGG - Intronic
1192667037 X:73099356-73099378 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1192685899 X:73305004-73305026 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1192843651 X:74882866-74882888 CCTCCCATTTAGGCTACTCAGGG - Intronic
1195395731 X:104408655-104408677 CCTCCCAGTTAGGCTACTCTGGG + Intergenic
1195452793 X:105034662-105034684 CCTCCCAGTTAGGCTACTCTGGG + Intronic
1197242473 X:124134607-124134629 CTTCCCATTTAACCTTCTCTGGG - Intronic
1198802378 X:140460801-140460823 CCTCCAATAGACCCGACCCTTGG + Intergenic
1199226088 X:145376333-145376355 CCTTCCATTTTCCACACCCTAGG + Intergenic
1200956171 Y:8948466-8948488 CCTCCCAGTTAGGCTACTCTTGG + Intergenic
1200962280 Y:9006558-9006580 GCTCACATCTACCCTATCCTAGG - Intergenic
1201541869 Y:15113822-15113844 CCTCCCAGTTAGGCTACACTGGG - Intergenic
1201702809 Y:16902485-16902507 CCTCCCAGTTAAGCTACTCTGGG - Intergenic
1201949808 Y:19550951-19550973 CTTCCCACTTCTCCTACCCTTGG - Intergenic
1202105069 Y:21355120-21355142 CCTCCCATTTAGGCTACTCAGGG - Intergenic
1202331412 Y:23756986-23757008 CCTCCCAGTTAGGCTACCCAAGG - Intergenic
1202539358 Y:25913074-25913096 CCTCCCAGTTAGGCTACCCAAGG + Intergenic