ID: 1008724149

View in Genome Browser
Species Human (GRCh38)
Location 6:54395496-54395518
Sequence TTTCAGTCTTTGTTCAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008724146_1008724149 11 Left 1008724146 6:54395462-54395484 CCAGGACTATTTATGTAAATAAG No data
Right 1008724149 6:54395496-54395518 TTTCAGTCTTTGTTCAACACAGG No data
1008724145_1008724149 12 Left 1008724145 6:54395461-54395483 CCCAGGACTATTTATGTAAATAA No data
Right 1008724149 6:54395496-54395518 TTTCAGTCTTTGTTCAACACAGG No data
1008724144_1008724149 21 Left 1008724144 6:54395452-54395474 CCACTTTGTCCCAGGACTATTTA No data
Right 1008724149 6:54395496-54395518 TTTCAGTCTTTGTTCAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008724149 Original CRISPR TTTCAGTCTTTGTTCAACAC AGG Intergenic
No off target data available for this crispr