ID: 1008734465

View in Genome Browser
Species Human (GRCh38)
Location 6:54526175-54526197
Sequence CACCATTAAAATGGGCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008734465_1008734470 -2 Left 1008734465 6:54526175-54526197 CCTAGGTGCCCATTTTAATGGTG No data
Right 1008734470 6:54526196-54526218 TGGATTGGATAAAGAAAATGAGG 0: 437
1: 1739
2: 9953
3: 30165
4: 15229
1008734465_1008734471 14 Left 1008734465 6:54526175-54526197 CCTAGGTGCCCATTTTAATGGTG No data
Right 1008734471 6:54526212-54526234 AATGAGGTACATATACACCATGG 0: 19
1: 3191
2: 26863
3: 15917
4: 9292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008734465 Original CRISPR CACCATTAAAATGGGCACCT AGG (reversed) Intergenic
No off target data available for this crispr