ID: 1008743724

View in Genome Browser
Species Human (GRCh38)
Location 6:54642733-54642755
Sequence TCCTGTGCATGTAGTGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008743722_1008743724 0 Left 1008743722 6:54642710-54642732 CCATGCTGCGGTGTTTCCTACAG No data
Right 1008743724 6:54642733-54642755 TCCTGTGCATGTAGTGCTGTAGG No data
1008743721_1008743724 1 Left 1008743721 6:54642709-54642731 CCCATGCTGCGGTGTTTCCTACA No data
Right 1008743724 6:54642733-54642755 TCCTGTGCATGTAGTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008743724 Original CRISPR TCCTGTGCATGTAGTGCTGT AGG Intergenic