ID: 1008745758

View in Genome Browser
Species Human (GRCh38)
Location 6:54667787-54667809
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 4, 1: 9, 2: 21, 3: 122, 4: 499}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008745758 Original CRISPR CTTTCAGCAGAGAGGGGACA TGG (reversed) Intergenic
903036492 1:20496213-20496235 CTTGAAGCAGAGGCGGGACATGG + Intergenic
904449408 1:30601321-30601343 CTTTCAGCAGAGAGGGGATGCGG - Intergenic
905106918 1:35569055-35569077 ATTTCAGCGGAGTGGGGAAAAGG + Intergenic
905107311 1:35572064-35572086 TTCTGAGCAGAGAGGGGCCAGGG + Intergenic
905471532 1:38195888-38195910 ATTTAATCAGAGTGGGGACAAGG - Intergenic
905880953 1:41463507-41463529 CTGTCTGCAGAGACGGCACAGGG - Intergenic
906660926 1:47580969-47580991 CTGTCTGCAGAGAAGGGCCAAGG + Intergenic
907424778 1:54372777-54372799 CATTCATAAAAGAGGGGACAGGG - Intronic
911435016 1:97845444-97845466 CTCTCAGCAGAAAGGAGACCTGG - Intronic
911605967 1:99905524-99905546 ATTTCAGCAAAGAGGGAAGATGG - Intronic
912346906 1:108972214-108972236 CTTTGAGGAGTGAGGGGAAAAGG - Intronic
914457348 1:147848203-147848225 CACTCATGAGAGAGGGGACAGGG + Intergenic
914730655 1:150366897-150366919 CACACAGCAGAGACGGGACAGGG - Intronic
915305501 1:154975012-154975034 CTCTCAGTAGAGAGGAGAGAGGG + Intronic
915901003 1:159846789-159846811 CTTTCTGAAGAAAGAGGACAAGG + Intronic
916198013 1:162243187-162243209 ATTGTAGCCGAGAGGGGACAAGG + Intronic
916817618 1:168368931-168368953 GTTTCAGCAGAGAAAGGACATGG + Intergenic
917468836 1:175308383-175308405 CTGAGAGCAGAAAGGGGACAAGG - Intergenic
917734481 1:177907889-177907911 CTTAGAGCAGGGAGGGGAAATGG - Intergenic
918029044 1:180785328-180785350 TTTTTAGCAGAGACAGGACAGGG + Intronic
918689725 1:187465770-187465792 CTTTGTGTAGAGAGGCGACAGGG + Intergenic
919162795 1:193853397-193853419 CTCTCAGCAGGGAGGGGAGCAGG - Intergenic
920136107 1:203770644-203770666 CTTTATGGAGAGAGGGGACTTGG - Intronic
921815970 1:219563789-219563811 CTTTGAGAAGAGAGGGGAGAAGG + Intergenic
921896821 1:220410439-220410461 CTTTCACCAGACAGGGGATGTGG + Intergenic
922019684 1:221691115-221691137 CTTTCAGCTGAGAATGGAAATGG + Intergenic
922097137 1:222452095-222452117 CATTCAGCAGACAGGGGAAGAGG + Intergenic
922334066 1:224604910-224604932 CTTTCAGAGGAGAGGGGACATGG + Intronic
922868913 1:228884229-228884251 CTTTCAGTGGAGAGGGGACATGG - Intergenic
924319903 1:242838636-242838658 CTCTCAGCAGAGAGGGGAGTTGG - Intergenic
1062854144 10:771168-771190 CGTTCAGCTTAGAGGAGACAGGG + Intergenic
1063062975 10:2577460-2577482 CTTTCAGCAAAATGGTGACAGGG + Intergenic
1063450306 10:6145923-6145945 CTTTGAGCTGAGAGGGGCCCAGG - Intronic
1063701006 10:8385467-8385489 CTTGCAGCAGGGTGGGAACATGG + Intergenic
1063758576 10:9044881-9044903 CTGTCAGCAGAGAGTGAACATGG + Intergenic
1064010349 10:11730421-11730443 CCCTCAGCAGAGAGGAGACCTGG - Intergenic
1064586145 10:16841480-16841502 ATTTCAGCAGAGCAGTGACATGG - Intronic
1064750076 10:18519543-18519565 CTTCTAGCAGAGAGGGGATGGGG - Intronic
1066490312 10:35888023-35888045 CTTTCAGCTGAGAGGGGACATGG + Intergenic
1067120940 10:43471615-43471637 CTCTCAGCAGAGAGGGGAACTGG + Intronic
1067200960 10:44171798-44171820 CTTTAAGCAGAGTAGGGACTGGG + Intergenic
1067266288 10:44748267-44748289 CTTTCAGCAAAGAGGGGAGCTGG + Intergenic
1067277715 10:44849896-44849918 CTCCCAGCAGAGAGGGGAAAAGG + Intergenic
1067406980 10:46032111-46032133 GTTTAAACAGATAGGGGACAGGG + Intergenic
1068051158 10:51950908-51950930 CTTTCTGCAGAGAGCGGACGTGG + Intronic
1068222696 10:54064177-54064199 CTCTCAGCAGAGAGAAGACCCGG + Intronic
1069142176 10:64840180-64840202 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
1069561746 10:69435663-69435685 CTCTCAGCAGAGAGGAGACCTGG + Intergenic
1070178829 10:73995868-73995890 CAATCAGCAAAGTGGGGACAGGG + Intergenic
1070746410 10:78936447-78936469 GCTTCTGCAGAGAGGGGAGAAGG + Intergenic
1071149770 10:82620392-82620414 CTCTCGGCAGAGAGGGGAGCTGG + Intronic
1071481553 10:86068838-86068860 CTGCCAGCAGAGAGGGCACTTGG - Intronic
1072871297 10:99124032-99124054 CCTTCAGCAAAAAGGGGACATGG + Intronic
1073001580 10:100289853-100289875 GTATCAGCAGAGATGGGTCATGG - Intronic
1073298456 10:102455798-102455820 CTTACAGCAGAGAGAGGGCGAGG - Intergenic
1073494656 10:103880175-103880197 TTTTCAACAGAGAGGAGACGTGG + Intergenic
1073622766 10:105066228-105066250 ATTTCAGGAGGGATGGGACAGGG - Intronic
1073639968 10:105241659-105241681 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1074301782 10:112240140-112240162 CTCTCAGCAGAGAGGAGACCAGG + Intergenic
1074617953 10:115089189-115089211 CTTGCAGATGAGAGGTGACAAGG - Intergenic
1074866927 10:117550004-117550026 CCTTCAGCAGATTGGGGCCAGGG - Intergenic
1076045496 10:127291310-127291332 CTTTGAGGATAAAGGGGACAGGG - Intronic
1076404990 10:130205729-130205751 CTTCCTGCAGGGAGGGGCCAGGG + Intergenic
1076714693 10:132357814-132357836 CTCTGAGCAGGGAGGGGACCAGG + Intronic
1077012864 11:386640-386662 CTCTCAGCAGAGAGGAGGCTGGG - Intergenic
1077275709 11:1706607-1706629 CTCTCAGCAGAGAGGGGAACTGG - Intergenic
1077735645 11:4787603-4787625 GGTTCAGCCGAGAGGGGCCAAGG - Intronic
1078047222 11:7926212-7926234 CTGTCAGCAGAGAGGGGATATGG - Intergenic
1078415408 11:11160740-11160762 CTTTCAGTGGAAAGGGGACACGG - Intergenic
1078874337 11:15378490-15378512 CTCTCAGCAGAGAGGAGACCTGG - Intergenic
1078926757 11:15882043-15882065 CTTTCAACTGAGAGGTAACATGG + Intergenic
1079348415 11:19672664-19672686 CCAGCAGCAGAGAGAGGACATGG + Intronic
1079646212 11:22866395-22866417 CTCTCAGCAGTGAGGGGAGCTGG - Intergenic
1080804125 11:35636320-35636342 CTTCCAGCAGAGAGAGGAGGGGG + Intergenic
1081038176 11:38176698-38176720 CTCTCAGTGGAGAGGGGAGATGG - Intergenic
1081463062 11:43289402-43289424 CCCTCAGCAGAGAGGGGATGTGG - Intergenic
1081597256 11:44467651-44467673 GTCCCAGCAGAGAGGGGCCATGG - Intergenic
1081767362 11:45621030-45621052 CCTTCAGCAGAAAGGAGACCTGG + Intergenic
1082275389 11:50215687-50215709 CTTTGAGAAGAGAGGGGAAAAGG + Intergenic
1082701184 11:56433215-56433237 CTCTCACCAGAGAGTGGACATGG + Intergenic
1082778057 11:57263208-57263230 GTTTCACCAGAGAGTGGCCATGG - Intergenic
1082875510 11:57984136-57984158 GTTTGAGCAGAGAGGTGACATGG - Intergenic
1083363539 11:62128012-62128034 CTGTGAGCAGAGAGGGGCCCTGG + Intronic
1084306440 11:68287644-68287666 CTTTCAGCAGACTGGCTACATGG - Intergenic
1084640936 11:70425313-70425335 CATTCTGCAGAGACAGGACATGG - Exonic
1084875009 11:72124622-72124644 CTCTCAGCAGAAAGGGGAGCTGG + Intronic
1086170009 11:83825669-83825691 AGCTCAGCACAGAGGGGACAGGG + Intronic
1086287460 11:85265869-85265891 CTTTCAGCAGACAGGGGAGCTGG - Intronic
1088716727 11:112555426-112555448 CTTTCAGCTGGGACGGGTCATGG + Intergenic
1089091757 11:115883915-115883937 CTGTAAGCAGGGAGGTGACATGG - Intergenic
1089374328 11:117983793-117983815 CTCTCAGCAGAGAGGGGATGGGG - Intergenic
1089568202 11:119383802-119383824 TTTTGAGCAGAGGAGGGACACGG + Intergenic
1089656480 11:119950663-119950685 CTTTCATCAGAGATGGCAGAAGG + Intergenic
1090150020 11:124374295-124374317 CTCTCAGCCGAGAGGGGATGTGG + Intergenic
1090376244 11:126291724-126291746 CTTTCAGCACTGAGGGGAGGTGG - Intronic
1091706248 12:2695398-2695420 ACATCAGCAGAGGGGGGACAGGG - Intronic
1091711479 12:2743628-2743650 ACATCAGCAGAGGGGGGACAGGG - Intergenic
1092300433 12:7243580-7243602 CTTTCAGAAAAGAGGGGAGGAGG + Intergenic
1092491912 12:8953219-8953241 CTCTCAGCGGAGAGGGGATGTGG + Intronic
1093448417 12:19287174-19287196 CTTTTAGTAGAGAAAGGACAGGG + Intronic
1093731230 12:22568032-22568054 CTCTCAGCGGAGAGGGGAGCTGG + Intergenic
1093755803 12:22850706-22850728 CTTTCAGCAGAGAAGGGAGTTGG + Intergenic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1094183652 12:27617998-27618020 CTTTCAGGAGAGAGGGAATGAGG - Intronic
1094191805 12:27705800-27705822 CTCTCAGCCGAGAGGGGAGCTGG + Intergenic
1095756297 12:45770610-45770632 CTCTCACCAAAGAGAGGACACGG + Intronic
1095914490 12:47463131-47463153 CTTTCAGTAGAAACTGGACAAGG + Intergenic
1096085255 12:48861371-48861393 CAGTCACCAGAGAGGGCACAAGG + Intronic
1097339288 12:58419146-58419168 TTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1097746601 12:63310482-63310504 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1097902254 12:64884742-64884764 CTTTGAGTGGATAGGGGACAAGG - Intergenic
1099886583 12:88538496-88538518 GTTTCAGCAGAGAAGGAACCTGG + Intronic
1099938170 12:89153071-89153093 CTCTGAGCAGAGATGGGACGCGG + Intergenic
1100557167 12:95707136-95707158 TTTTCAGCAGAGAAGTGGCATGG - Intronic
1101901984 12:108797732-108797754 CCCTCAGCAGAGAGGGGAGCTGG - Intronic
1102248691 12:111371063-111371085 TTTTGAGCAGAGGAGGGACATGG + Intergenic
1102663416 12:114549195-114549217 TTTTTAGCAGAGAGGGGACATGG + Intergenic
1102757554 12:115355259-115355281 TTTTAAGCAGAGATGTGACAGGG + Intergenic
1102792702 12:115660597-115660619 GTTTCAGCAGAGAGAGCACAAGG - Intergenic
1102940447 12:116936887-116936909 CTTTGAGCAGAGGGGTGACAAGG + Intronic
1104235968 12:126936906-126936928 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1104643964 12:130484159-130484181 CTTTCAGCTGGGATGCGACATGG - Intronic
1104820159 12:131672481-131672503 CTTTGAGCAGGGAAGGGACAAGG - Intergenic
1106032388 13:26014974-26014996 CATTCATCAGAGAGGCAACACGG - Intronic
1106627379 13:31434460-31434482 CTCTCAGCAGAAAGGGGAACTGG + Intergenic
1107037053 13:35912602-35912624 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1107823203 13:44304850-44304872 CTTTCAGCAGAGAGAGGACACGG + Intergenic
1107911118 13:45106638-45106660 CTCTCAGCAAAGAGGGGAGCCGG + Intergenic
1109136414 13:58656783-58656805 CTCTCAGCAGAGAGGGAAGCTGG + Intergenic
1109232143 13:59770413-59770435 GTTTCATCAGAGTGGAGACAAGG - Intronic
1109422981 13:62137766-62137788 CTTTCAGCAGAGAGGGAATGGGG - Intergenic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1110290823 13:73805022-73805044 TTGTCAGCAGAGAAGAGACATGG + Intronic
1110338745 13:74364367-74364389 GTTTCAGGGGAGAAGGGACAGGG - Intergenic
1111213313 13:85108969-85108991 CTCTCAGCAGAGAGGGGATATGG + Intergenic
1111726250 13:92013276-92013298 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1112062518 13:95755442-95755464 CTTTAAAGAGACAGGGGACAGGG - Intronic
1112086169 13:96034295-96034317 CTGTCACTAGAGAGGAGACATGG - Intronic
1112329329 13:98464899-98464921 CTTTCAGCAGACAGGAAAAAGGG - Intronic
1112640984 13:101274954-101274976 GTTCCAGCAGAGATGGGGCAAGG + Intronic
1113167443 13:107458291-107458313 CTTTACTCAGAGAGGGGACCAGG + Intronic
1114782281 14:25551175-25551197 CTTTCTGCAGAGAAGAGAGAGGG + Intergenic
1116125980 14:40785414-40785436 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1116151243 14:41145127-41145149 CTGTCAGTAGAGAGGAGACCAGG + Intergenic
1116383558 14:44301951-44301973 CTTTCAGTGGAAAGGGGATATGG - Intergenic
1116523805 14:45880457-45880479 CTCTCAGCAGAAAGGGGAACTGG - Intergenic
1116541491 14:46107461-46107483 CTCTCAGCAGAGAGGAGACTGGG + Intergenic
1116945008 14:50829067-50829089 CATTCTGCAGAGTGGGGAAAAGG - Intronic
1117084751 14:52188024-52188046 CTTTCAGCAGGAAGGGGATGTGG - Intergenic
1117928575 14:60812818-60812840 CTCTTAGCAGAGAGGGGAGCTGG - Intronic
1118331018 14:64816109-64816131 CTTTCAGCAGGGAAATGACACGG - Intronic
1118483873 14:66195789-66195811 CTTTCCATGGAGAGGGGACATGG + Intergenic
1118486152 14:66216023-66216045 TTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1118696061 14:68386433-68386455 CTTACAGCAAAGAGAGGACTGGG - Intronic
1120028295 14:79610860-79610882 CTTGCAGCATAAAGGGTACATGG - Intronic
1120821282 14:88914012-88914034 GATCCAGCAGAGAGGGGGCATGG + Intergenic
1120883318 14:89432143-89432165 CCTTCCACAGAGAGGTGACAGGG - Intronic
1124231948 15:27953411-27953433 CCTTCCCCAGAGAGGCGACAGGG - Intronic
1124930478 15:34114810-34114832 CTCTCAGCAGAGAGGAGAGCTGG - Intergenic
1125722013 15:41849704-41849726 CTCTCAGCTGAGAGTGGGCAGGG + Intronic
1126088350 15:45029785-45029807 CTTTCAGCAGAGAAGGGAACTGG + Intronic
1126156844 15:45573951-45573973 CTCTCAGCAGAGAGGAGGCCTGG + Intergenic
1126478683 15:49093956-49093978 CTGTCATCAGAGAGTGGACCAGG + Intergenic
1127159980 15:56172165-56172187 TATTCAGCAGTGAGGGGTCATGG + Intronic
1127372086 15:58350808-58350830 CTTTCAGAAGCTGGGGGACAAGG - Intronic
1127541667 15:59945101-59945123 CTTTCAGCAGTGTGGGGCCTGGG - Intergenic
1127623994 15:60762442-60762464 CTTTCACCATAGATGGGGCAAGG - Intronic
1128227744 15:66013979-66014001 CTTTGAGCAGAGGAGGGCCATGG + Intronic
1128548181 15:68581104-68581126 CTTGAAGCAGGGATGGGACAGGG + Intronic
1128615310 15:69104401-69104423 GTTTCAGAAGAGAGGGGATGTGG + Intergenic
1128637088 15:69309586-69309608 CTCTGAGGAGGGAGGGGACAGGG - Intronic
1128676159 15:69610218-69610240 TTTTCAGAAGAGTGGGGAGAGGG - Intergenic
1128681757 15:69657581-69657603 TTTTAAGTATAGAGGGGACATGG - Intergenic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1129423274 15:75447135-75447157 TTTTAAGCAGAGAAGTGACACGG + Intronic
1129816576 15:78560217-78560239 CTTTCAACATTTAGGGGACATGG + Intergenic
1129842584 15:78752944-78752966 CCTTCTGCAGAGAGGTGACAAGG - Intergenic
1131304443 15:91229170-91229192 CTTCCAACAGAAAGGGAACATGG + Intronic
1131514001 15:93065666-93065688 CTTCCAGCAGAGAGGGCAGCAGG - Intronic
1131892632 15:96989174-96989196 CTTTCAGAACAGAGAGCACAAGG - Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133087671 16:3377673-3377695 CTGTCAGCTGAGAGGAGCCATGG + Intronic
1133857229 16:9560905-9560927 ATTTGAGCAGAGTGGGGTCAAGG + Intergenic
1133969421 16:10556905-10556927 AGATCAGCAGAGAGGGCACAAGG + Intronic
1133997478 16:10759334-10759356 CATCCTGCAGAGAGGGGACATGG + Intronic
1134621295 16:15691445-15691467 CTTTGAGCAGAGAGTAGACTGGG + Intronic
1134812735 16:17181193-17181215 CTTGCAGCAGGGAGGGAATATGG + Intronic
1135272205 16:21079123-21079145 TTTTCAGCAGTGAAGGGTCATGG + Intronic
1135807199 16:25553676-25553698 TTTGCCACAGAGAGGGGACATGG + Intergenic
1135926821 16:26702080-26702102 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1136086410 16:27888268-27888290 CTTTCAGAAGTGATGGGAGATGG + Intronic
1137613885 16:49835781-49835803 GTTTCAGCAGGGAGGGGAAGAGG + Intronic
1138152331 16:54670235-54670257 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1138343482 16:56306128-56306150 CTTTCAACAAAGAGGGAGCAGGG - Intronic
1138655572 16:58489305-58489327 CGTTAAGCAGAGAAGTGACATGG - Intronic
1139291723 16:65864483-65864505 CTCTCAGCAGAGAGGGGATGTGG - Intergenic
1139574344 16:67831772-67831794 GTTTCAGCAGGGAGTGGACCAGG - Exonic
1139739774 16:69025308-69025330 CTCTCAGCAGAGAAGGGAGCTGG + Intronic
1140358570 16:74325961-74325983 ACTCCAGCATAGAGGGGACAGGG - Intergenic
1140483268 16:75274241-75274263 GTTTCAGCAGGAAAGGGACATGG - Intergenic
1141263650 16:82476083-82476105 CATTTACCAGAGTGGGGACAGGG - Intergenic
1141959867 16:87398198-87398220 CTTTTAGTAGAGACGGGACAGGG + Intronic
1141993721 16:87623990-87624012 CTGTCAGCTGGGAGGGGACAGGG + Intronic
1142007862 16:87698607-87698629 CTTCCAGCAGCGAGGGCAGAGGG + Intronic
1142020138 16:87777155-87777177 CTGGCAGCAGAGAGGGGAGCAGG - Intergenic
1142593605 17:1018970-1018992 GTTTCAGCAGAGAGGGTGCTGGG - Intronic
1142614619 17:1127157-1127179 CATTCAGCTGCCAGGGGACATGG + Intronic
1143476637 17:7207060-7207082 CTGTGAGCAGAGAGGAGAAAGGG + Intronic
1143570514 17:7755151-7755173 CTTTCTGCAGAGAGGGCAACAGG + Intronic
1144771308 17:17761088-17761110 CTCTGAGCACAGAGAGGACAAGG - Intronic
1145288183 17:21522110-21522132 CTTGCAGCAGAGAGCAGAAATGG - Intergenic
1145366765 17:22271797-22271819 CTTTTAGCAGAGAAGGGAGTGGG + Intergenic
1145389455 17:22444333-22444355 CTTGCAGCAGAGAGCAGAAATGG + Intergenic
1145967707 17:28932064-28932086 CTTGAAGCAGAGAGGAAACATGG - Intronic
1146628839 17:34455603-34455625 TTTTAAGCAAAGAAGGGACATGG + Intergenic
1148071825 17:44913131-44913153 CTTTCACCAGAGAAGTGAGATGG - Intronic
1148790317 17:50169049-50169071 CTGTCAGCAGAGTGGGGGCAGGG - Intronic
1150201460 17:63361974-63361996 CCCTCAGCAGAGAGGAGACCTGG + Intronic
1150201470 17:63362044-63362066 CCCTCAGCAGAGAGGAGACCTGG + Intronic
1150201481 17:63362114-63362136 CCCTCAGCAGAGAGGAGACCTGG + Intronic
1150201495 17:63362184-63362206 CTCTCAGGGGAGAGGAGACATGG + Intronic
1150320575 17:64210880-64210902 CCTTCTGCAGAGAGGTGTCATGG + Intronic
1151432933 17:74076864-74076886 TTTTCTGCAGAGAGGGTCCATGG - Intergenic
1152499232 17:80697151-80697173 CTTTCTGCAGAGAGGGGACATGG + Intronic
1153821648 18:8837280-8837302 CTCTCAGCAGAGAGGGGCCATGG + Intergenic
1154156088 18:11945325-11945347 CTTTTAGCGGGGAAGGGACATGG - Intergenic
1155017867 18:21863456-21863478 CTCTCAGCAGAGAGGGGAACTGG + Intronic
1155086377 18:22463275-22463297 CTGTCAGCAAAGTGGAGACAGGG - Intergenic
1155637786 18:27975849-27975871 CTCTCAGCAGAGAGGGGAGCTGG + Intronic
1155769732 18:29681515-29681537 TTCTCAGCAGAGAGGATACATGG - Intergenic
1156163358 18:34386864-34386886 CTTTAGACAGAGAGGGTACATGG - Intergenic
1156646312 18:39166148-39166170 CTATCTTCAGAGAGGGGAGAAGG + Intergenic
1156905604 18:42348661-42348683 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1156993714 18:43440538-43440560 CTCTCAGCAAAGAGGGGACTTGG - Intergenic
1157023852 18:43819224-43819246 CATGCAGCTGAGAGGGCACATGG - Intergenic
1157554657 18:48605641-48605663 CTTGCAGCAGAGAGCCCACAGGG - Intronic
1157950990 18:52036687-52036709 TTTTCAGTAGAGATGGGCCAGGG - Intergenic
1158186717 18:54779938-54779960 CCGTCAGGAGAGGGGGGACATGG - Intronic
1158186745 18:54780040-54780062 CTGTCAGGAGAGGGGAGACACGG - Intronic
1158488486 18:57889291-57889313 CTTTCAGCAGAAAGGGGATGTGG + Intergenic
1159076264 18:63685108-63685130 CTTTCAGTGGAGAGGGAACATGG + Intronic
1159591612 18:70341339-70341361 CTTTCAGAAGAGAATAGACATGG + Intronic
1160083545 18:75753616-75753638 CCCTCAGCAGAGAGGAGACCCGG + Intergenic
1160127470 18:76189608-76189630 CTTTCAGCAGGATGGGGAGATGG - Intergenic
1160462283 18:79048301-79048323 CTGGCAGCAGAGAAGGGCCACGG - Intergenic
1161512327 19:4678712-4678734 CTTTCAACAGAGCAGGGAAATGG - Intronic
1161570411 19:5027423-5027445 TTCTCAGCTGAGAGAGGACAAGG - Intronic
1162071001 19:8151956-8151978 CCTCCAGAAGAGAGGGGAGAAGG + Intronic
1163122089 19:15224054-15224076 TTTTCAGCAGGGAAGGGACATGG - Intergenic
1163389480 19:17021726-17021748 CTTTGACCAGAGGTGGGACAGGG - Intronic
1163511015 19:17734990-17735012 ATTTCTGCAGAGAGGGGTCAGGG - Intergenic
1164706827 19:30325967-30325989 GATTTAGCAGAGAGGAGACAAGG - Intronic
1165075033 19:33275865-33275887 CACCCAGCAGGGAGGGGACAGGG - Intergenic
1165122375 19:33568525-33568547 GTTTCAGCAGGGTTGGGACAGGG - Intergenic
1165401167 19:35601260-35601282 GTTTTAGGAGAGAGGGAACAGGG - Intergenic
1165773414 19:38390791-38390813 TTTTGAGCAGAGGAGGGACATGG - Intronic
1167569959 19:50280730-50280752 CTGTGAGCAGAGGAGGGACAGGG - Intronic
1168125027 19:54278224-54278246 CTTTGAGCTCAGAGAGGACAGGG + Intronic
1168133634 19:54336805-54336827 CTTTGAGCTCAGAGTGGACAGGG + Intronic
1168176959 19:54633332-54633354 CTTTGAGCTCAGAGAGGACAGGG - Intronic
1168185773 19:54698511-54698533 CTTTGAGCTCAGAGAGGACAGGG - Intronic
925224086 2:2167513-2167535 GTTTAAGCAAAGAGGAGACAGGG - Intronic
925274920 2:2641810-2641832 CTGTCAGGAAATAGGGGACATGG + Intergenic
925310543 2:2878560-2878582 CTCTCAGCAAAGAGGGGAGCTGG + Intergenic
925760710 2:7181863-7181885 ATCTCAGCAGGGAGGGGACCAGG + Intergenic
925825412 2:7843655-7843677 CTTTCTGCAGAGTGTGGACAGGG + Intergenic
925841494 2:7996036-7996058 CTGTCAGCAGGGAGGGGACCTGG + Intergenic
925876688 2:8317326-8317348 TTTTCAGGAGAGAGGGAACATGG + Intergenic
925917026 2:8614189-8614211 CTGTTGGCAAAGAGGGGACAAGG + Intergenic
926562713 2:14435123-14435145 CTTTCAGCGGAGAGGGGAGCTGG + Intergenic
926765422 2:16319331-16319353 GTTTCCGAAGAGAGGGGAGATGG - Intergenic
926889877 2:17629838-17629860 CTCTCAGCTGAGAGGGGACACGG + Intronic
927847665 2:26479808-26479830 CTCTCAGCGGAGTGGGGACACGG - Intronic
927895433 2:26778612-26778634 GGTTCTGCAGGGAGGGGACAGGG - Exonic
928516645 2:32050485-32050507 TTTTCAGTAGAGCGGGGGCAGGG - Intergenic
928913493 2:36446747-36446769 CTTTCAGGAGAGGGTGGAGAGGG + Intronic
929094929 2:38254426-38254448 CTTTCAATGGAGAGGGGACATGG + Intergenic
929664590 2:43823771-43823793 CTTTCCCCAGAGAGGGAACCTGG + Intronic
930042423 2:47137515-47137537 CTTTCAGAAGATAGAGGGCAGGG - Intronic
930957299 2:57217800-57217822 CTCTCAGCAGAGAAGAGACCTGG - Intergenic
932088906 2:68787508-68787530 GTTTCAGCATAGATGAGACAGGG - Intronic
932644616 2:73487886-73487908 CTTTCAGCAGAGAAGAGACCCGG + Intronic
933103299 2:78287667-78287689 CTCTCAGCAAAGAGGGGACATGG - Intergenic
933258577 2:80107509-80107531 CTATCAGCAGAGAGGGGAGCAGG - Intronic
933298225 2:80514595-80514617 CTCTCAGAAGAGAGGGGAGTGGG + Intronic
933444677 2:82364897-82364919 CTTTAAGCAGGGAGGGGATGTGG + Intergenic
933616451 2:84486776-84486798 CATTCAGCAGACAAGAGACAAGG + Intergenic
933624667 2:84585590-84585612 CTCTCAGCAGAGAGGAGGCCTGG + Intronic
933714101 2:85347754-85347776 CTTTCAGCTGAAAGGGGTCCAGG - Intronic
934758347 2:96839813-96839835 TTCTCAGCAGGAAGGGGACACGG - Exonic
935783427 2:106527899-106527921 CTTTCAGCAGAGAGGGGGTGTGG - Intergenic
936813964 2:116436611-116436633 CTTTTAGTAGAGACGGGACGGGG - Intergenic
936846562 2:116842031-116842053 CTCTCAGCAGAGAGGGGATCTGG - Intergenic
937849765 2:126621743-126621765 CTTTCAGTGGAGAGGGGTCACGG + Intergenic
939346716 2:140975453-140975475 CTTCAGGCAGAGAGGAGACATGG - Intronic
939661337 2:144894369-144894391 CTTTCAGCAAACAGGGGAATAGG + Intergenic
939798550 2:146678720-146678742 CTTTCACCAGCGAGGGCAAAGGG + Intergenic
939879656 2:147615535-147615557 CTTTGAGAAGGGAGGGGAAAGGG + Intergenic
940168762 2:150803899-150803921 CTCTCAGCAAAGAGGGGACATGG + Intergenic
940173134 2:150850050-150850072 CTCCCAGCAGAGAGGGGAGCTGG + Intergenic
942114309 2:172712999-172713021 CCATCAGCAGAGAGGAGACCTGG + Intergenic
942206710 2:173626344-173626366 CTTTCAGGAAATAGTGGACAGGG - Intergenic
942901880 2:181129792-181129814 CTTTCAGTGGAGAGGGGATGTGG - Intergenic
943483677 2:188454232-188454254 CTCTCAGCAGAGAGGGGATGTGG + Intronic
943946735 2:194074634-194074656 CTCTCTGCAAAGAAGGGACATGG - Intergenic
943985445 2:194612089-194612111 CTTTCAGCAGAGAGGGGATGTGG - Intergenic
945831694 2:214795135-214795157 CTTGCTACAGAGTGGGGACAGGG + Intronic
946252318 2:218421235-218421257 GTGCCAGCAGAGAGGGGCCAGGG + Intronic
946365456 2:219246182-219246204 CTGTCAGGTGAGAGAGGACAGGG - Intronic
946907423 2:224430134-224430156 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
947051654 2:226051129-226051151 TCTTCAACAGAGATGGGACAAGG - Intergenic
948607182 2:239143609-239143631 CCTCAAGTAGAGAGGGGACAGGG + Intronic
949063720 2:241976414-241976436 GTCACAGCAGAGAGAGGACATGG - Intergenic
1168800233 20:640063-640085 CTTTGAGCAGAGGAAGGACATGG - Intergenic
1168958755 20:1853709-1853731 CTTTTAGCAGAGAGCTGACTGGG - Intergenic
1170395773 20:15923586-15923608 GGTTCAGCGGAGATGGGACAGGG - Intronic
1170696566 20:18664698-18664720 TTTTAAGCAGAGAGATGACATGG + Intronic
1170864765 20:20143384-20143406 CTCCCAGCAAAGAGGGGACTCGG + Intronic
1171013732 20:21522338-21522360 CTGCCAGCAGAGAGGGGTCTCGG - Intergenic
1171404190 20:24898816-24898838 CTTTCAGCAGAGAGGGGACCTGG + Intergenic
1172131620 20:32659796-32659818 CTTTCACCTGTGAGGGGCCATGG + Intergenic
1172479648 20:35263605-35263627 CTCTCTGCAGAGCAGGGACAAGG - Intronic
1172739237 20:37152474-37152496 TCTTGAGCAGAGAAGGGACATGG + Intronic
1173662933 20:44746362-44746384 CATTCAGCAGAGGGGGGCAAAGG - Intronic
1173703921 20:45096364-45096386 CTCTCTGCATGGAGGGGACAGGG + Intronic
1173801777 20:45898671-45898693 CTTTAAGCAGAGAAGGGGCCAGG - Exonic
1174135537 20:48376283-48376305 GTTTCAGCAGAGACAGGACATGG + Intergenic
1174545831 20:51324457-51324479 CATTCAACATAGAGGGGAGATGG + Intergenic
1175372935 20:58504718-58504740 CTCACAGCAGGGAGGGCACAGGG + Intronic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1175425308 20:58861280-58861302 TTTTCAAGAGAGAAGGGACAGGG + Intronic
1176836000 21:13793888-13793910 CCTTCTGCAGGGAGGAGACATGG + Intergenic
1176965799 21:15210249-15210271 CTTTCCCAAGAGAGGAGACAGGG + Intergenic
1177116080 21:17088497-17088519 GATTCAGGAGAGAGGAGACAAGG - Intergenic
1177962089 21:27679948-27679970 CTCTCAGCAGAGATGGGAGCTGG + Intergenic
1178395410 21:32238513-32238535 CTTACAGCAGGGTGGGGTCATGG - Intergenic
1178429051 21:32503008-32503030 CTTTGAGGAGAGACGGCACAGGG - Intronic
1178466545 21:32853650-32853672 CTCTCAGTGGAGAGGGAACATGG + Intergenic
1178624507 21:34203888-34203910 CTTTGAGCAGAGACCTGACAGGG + Intergenic
1179381491 21:40903357-40903379 TTTTTGGCAGAGAGAGGACAGGG - Intergenic
1181129320 22:20721129-20721151 CTTTCAGCACACAGGGGAGCAGG - Intronic
1181399133 22:22640624-22640646 CTTTCAGCAGAAAGGGATTAAGG - Intergenic
1181650290 22:24255435-24255457 CTTTCAGCAGAAAGGGAGTAAGG + Intergenic
1181775613 22:25158245-25158267 CTGACATTAGAGAGGGGACAGGG + Intronic
1182424643 22:30265717-30265739 CTGTCAGGAAAGTGGGGACATGG - Intronic
1182473269 22:30561513-30561535 CATTCAGCAAAGCGGGGGCAGGG + Intronic
1183373635 22:37449605-37449627 TTTTCAGCATCGAGGGGAGAGGG + Intergenic
1183482142 22:38070943-38070965 CTCTCAGCAGAGTGGCAACAGGG + Intronic
1183913570 22:41098140-41098162 TTTTTAGCAGGGAGGGGAGAGGG - Intronic
1184054234 22:42033725-42033747 CTCTCAACAGAGAGGGGTCCTGG + Intronic
1184239313 22:43203662-43203684 GTTTCAGGAGAGAGGGGAAGTGG - Exonic
1184405649 22:44299002-44299024 CTTTCATCAGTGAGGGGAGGAGG - Intronic
1184802155 22:46767977-46767999 CTTTGAGCAGAGAAGTGGCATGG + Intronic
949227405 3:1711163-1711185 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949258543 3:2079492-2079514 CTTTCAGTGGAAAGGGGACGGGG - Intergenic
949474603 3:4431503-4431525 CTCTCAGTGGAGAGGGGACATGG - Intronic
949675434 3:6447909-6447931 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
949745891 3:7291763-7291785 CTATCAGCAAAGATGGGAGAGGG + Intronic
950083227 3:10238657-10238679 CTCCCAGCAGAGAGGGGGCGGGG - Intronic
950643328 3:14362283-14362305 GTTTCTGCAGAGAGGGGCCTTGG - Intergenic
950734408 3:14993788-14993810 CTTTTACCTGAGAGGGGGCATGG - Intronic
953134539 3:40171331-40171353 TTTCCAGCAGAGAGTGGAAAAGG + Intronic
953280143 3:41547353-41547375 AATTCAGCAGGGAAGGGACAGGG + Intronic
954229908 3:49208817-49208839 CTACCAACAGAGAGGGTACATGG + Intronic
954468249 3:50670539-50670561 TTTTCAGTAGGGAGGGGATAGGG - Intergenic
954471456 3:50699687-50699709 TCTTCTGCAGAGAGGGGACAAGG + Intronic
954755817 3:52839122-52839144 CATTCCCCAGGGAGGGGACACGG + Exonic
955578963 3:60398017-60398039 CTCTCAGCAAAGAGGGGATGTGG - Intronic
955755507 3:62221431-62221453 CATACAGCCTAGAGGGGACAAGG + Intronic
955838420 3:63084486-63084508 CTATGAGCAGAGTAGGGACAGGG + Intergenic
957346955 3:78973334-78973356 TTTTCAGTACAAAGGGGACATGG - Intronic
958141772 3:89571239-89571261 CTCTCAGCAGAGAGGAGACCCGG + Intergenic
958170037 3:89927836-89927858 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
958540533 3:95465071-95465093 CTCTCAGTGGAGAGGGCACATGG + Intergenic
958633874 3:96717191-96717213 CTTGCAGAAGAGAGAGGAAATGG + Intergenic
958636299 3:96750881-96750903 CTTTCAGCAGAGAGGAGGCCTGG - Intergenic
959062089 3:101625159-101625181 GTTTCAGCAGAGAGGGAATGTGG + Intergenic
959693533 3:109224719-109224741 CTCTCAGCAGAGAGGGGAGCCGG + Intergenic
960338414 3:116445810-116445832 TGTTCAGGAGAGAGGGGAGAAGG + Intronic
961330474 3:126135299-126135321 ATTTCAGCAGAGTGGGCTCAGGG - Intronic
961357391 3:126347747-126347769 ATGTCACCAGAGAAGGGACAGGG + Intronic
961439789 3:126945877-126945899 TTTCCAGCAGAGAGGCGGCAAGG + Intronic
961493651 3:127274941-127274963 CTCTCAGCAGAGAGGAGGCCTGG - Intergenic
961598917 3:128043505-128043527 CTCTCAGCAGAGAAGGGAGCTGG + Intergenic
961760338 3:129162483-129162505 CTCTCAGCAGAGAAAGGAAAAGG - Intergenic
962474359 3:135742373-135742395 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
962636468 3:137337247-137337269 CTTCTAGCAGAAAGGGGACACGG - Intergenic
962894408 3:139701012-139701034 CTTTCAGAAGAGAGAGAAGAGGG + Intergenic
963251052 3:143103904-143103926 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
963378828 3:144503834-144503856 CTCTCAGCAGAGAGGGGAGATGG + Intergenic
964680417 3:159331824-159331846 CTTTAAGCAGAGAATGAACATGG - Intronic
964920542 3:161890759-161890781 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
964927802 3:161978772-161978794 CCCTCAGCAGAGAGGAGACCCGG + Intergenic
965039702 3:163490574-163490596 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965078712 3:164010304-164010326 CTGTCGGCAGGTAGGGGACAAGG + Intergenic
965115072 3:164477977-164477999 CCTTCAGCAGAGAAGAGACATGG - Intergenic
965123643 3:164595671-164595693 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
965573331 3:170192906-170192928 TTTTTTGCAGGGAGGGGACAGGG + Intergenic
965890893 3:173512365-173512387 CTCTCAGTAGAGAGGGGAGCTGG + Intronic
965910828 3:173773148-173773170 CTTTGAGCACAGTGGGGAAAAGG - Intronic
966256177 3:177918360-177918382 CTCTCAGCAGAGAGGAGGCCTGG - Intergenic
966921549 3:184615034-184615056 ATTTCAGGAGAGATGGGCCAGGG - Intronic
967130807 3:186469195-186469217 CTTGCAGCAGGGAGGGAAGATGG - Intergenic
969348357 4:6583136-6583158 CTTCCAGCAGCTAGGGGATAGGG + Intronic
969501211 4:7554429-7554451 GTGTCAGCACAGAGAGGACATGG - Intronic
969553401 4:7888408-7888430 CAGTAAGGAGAGAGGGGACATGG + Intronic
969994294 4:11295685-11295707 CTTTCAGGAGATAGTGGAGATGG - Intergenic
970203925 4:13637044-13637066 ATTTCAACAGAGAAGGGAGAAGG + Intergenic
970664319 4:18319417-18319439 ATTTCAGCATAGCGGGGACAGGG - Intergenic
971959824 4:33471348-33471370 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
972286320 4:37651813-37651835 CTTTCAGCAGAGAGGCAATGTGG - Intronic
972347362 4:38203832-38203854 CTTTCAGCAGAGTTGAGTCAGGG - Intergenic
972763758 4:42132337-42132359 CTTTCAGCAGCAAGAGGTCAGGG + Intronic
973097456 4:46220238-46220260 ATTTAAGCAGAGAGTGGACGTGG - Intergenic
973238606 4:47932795-47932817 CTCTCAGCAAAGCGGGGACGTGG + Intronic
973822143 4:54671089-54671111 GTGCCAGCAGAGAGGTGACAGGG + Intronic
973917828 4:55654547-55654569 CTTTCAGTGGAAAGGGGACAGGG + Intergenic
977220475 4:94332210-94332232 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
977364982 4:96056487-96056509 CTTCCACCAGCGAGGGGAAAGGG - Intergenic
978232133 4:106412446-106412468 CCTTCTCCAGAGAGGGGAGAGGG - Intergenic
978730997 4:112026116-112026138 CTGTCAGCAGGGAGGGGAAAGGG + Intergenic
978964216 4:114722474-114722496 TTTACAGCAGAAAGGGGATATGG + Intergenic
978964512 4:114725269-114725291 CTCTCAGCAGAGAGGAGGCCCGG + Intergenic
979188117 4:117824318-117824340 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
979637841 4:122977853-122977875 CTCTCAGCAGAGAGGATACCTGG + Intronic
979637853 4:122977923-122977945 CTTTCCGCAGAGAGGACACCTGG + Intronic
979637894 4:122978194-122978216 CTCTCAGCAGAGAGGAGACCTGG + Intronic
979649450 4:123113902-123113924 CTCTCAGCAGAGAGGAGGCCTGG + Intronic
980680645 4:136155403-136155425 CTCTCAGCTGAGAGGGGAGCTGG + Intergenic
980729136 4:136804668-136804690 CTTTCAGCAGAGAGGGGAGATGG - Intergenic
982099203 4:151952141-151952163 CTTTCAGCAGAGATGGGTTAAGG + Intergenic
982106846 4:152018659-152018681 CTTTCAGCAGGGAAGGGAGAAGG - Intergenic
982602383 4:157468849-157468871 CTTTTAGCAGAGATGGGATGTGG - Intergenic
982786050 4:159538178-159538200 CTTTCACTAGAGAGAGGATAGGG - Intergenic
982807997 4:159790087-159790109 GCTTTAGCAGAGATGGGACAGGG + Intergenic
983316519 4:166139456-166139478 CTGGAAGCAGAGTGGGGACATGG - Intergenic
983697868 4:170554623-170554645 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
983773496 4:171578118-171578140 CTCTCAGTAGACAGGGGTCATGG + Intergenic
984072815 4:175136671-175136693 TTTTCACCATAGAGGGGAAAAGG + Intergenic
984272748 4:177567654-177567676 CTTTGAGCAGAGAAGAGAGATGG + Intergenic
984371028 4:178864242-178864264 CTCTCAGCTGAGAGGGGATGTGG + Intergenic
984731266 4:183070063-183070085 TGTGCAGCAGAGAGGGAACAAGG + Intergenic
985101218 4:186460372-186460394 CTCTCAGCAGAGAGGGGACGCGG + Intronic
985707249 5:1408684-1408706 GTTTCAGCAGGGATGTGACATGG - Intronic
986031308 5:3895259-3895281 CTGTCAGGGGATAGGGGACAAGG - Intergenic
986164749 5:5263963-5263985 CTCTCAGCAGAGAGGGTAGCTGG + Intronic
986182203 5:5403672-5403694 CAGTCAGCAGAGAGCTGACAGGG + Intergenic
987486445 5:18532976-18532998 CTCTTAGCAGAGAGGGGAGCTGG - Intergenic
987520041 5:18970064-18970086 GTTTCAGCAAAGAGGGAAGATGG + Intergenic
987652912 5:20767599-20767621 CTGTTAGCAGAAAGGAGACATGG + Intergenic
988361329 5:30239864-30239886 CTCTCAGTGGAGAGGGGACATGG - Intergenic
988742651 5:34093885-34093907 CTGTTAGCAGAAAGGAGACATGG - Intronic
988782733 5:34538140-34538162 CTTTCAGTGGAGAGGGGACAGGG + Intergenic
989132054 5:38116713-38116735 CTCTCAGCAGTGGGGAGACAGGG - Intergenic
989807666 5:45630243-45630265 ATTTAAGCAGAGAGGGAGCAAGG + Intronic
990023780 5:51160278-51160300 CTCTCAGCAGAGAGGAGGCCTGG - Intergenic
990499019 5:56376528-56376550 CTTTCAGCAGAATGGGGAGCTGG + Intergenic
990683863 5:58278009-58278031 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
990992723 5:61701252-61701274 CTTTCAGAAGAGTGGGGAAGGGG + Intronic
991651703 5:68862297-68862319 CTCTGAGCAGAGAGGGGACCAGG - Intergenic
993292711 5:86095805-86095827 CTCTCAGCAGAAAGGGGATGTGG + Intergenic
993403325 5:87480068-87480090 CTTCCAGGAAAGAGGGGATATGG - Intergenic
993409750 5:87558988-87559010 ATTTCAGCTGAGAGCAGACATGG - Intergenic
994852529 5:105074291-105074313 CTTTAAGAAGAGATGGGAGAGGG - Intergenic
995344678 5:111098308-111098330 CTTTCAGATGAGATGGGAAAGGG - Intronic
995679198 5:114698112-114698134 CTTTCAGATGAGAGAGTACAAGG - Intergenic
995724046 5:115166437-115166459 CTCTCAGCAGAGAAGAGACCCGG - Intronic
996294088 5:121890831-121890853 CTCTCAGTAGAGAGGGGACCTGG + Intergenic
1000057296 5:157618710-157618732 CTTTTAGCAGAGAGGGGACATGG + Intergenic
1001214360 5:169841506-169841528 GTTTCAGCAGAGGAGTGACATGG - Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1001973732 5:175979340-175979362 CTCTCAGCGGAGAGGGGAGTTGG - Intronic
1001996235 5:176161373-176161395 CTTCCAGCAGGGAGGGGGAAAGG + Intergenic
1002055466 5:176595906-176595928 CTCACAGCACAGGGGGGACAAGG + Exonic
1002243700 5:177864439-177864461 CTCTCAGCGGAGAGGGGAGTTGG + Intergenic
1002810534 6:623635-623657 GTTTCAGCAGAGAGGGTCCAGGG - Intronic
1003811584 6:9788877-9788899 CTATCAGCAGAGAGTGGTCCAGG + Intronic
1004983258 6:21050488-21050510 CTTTCAGTCAAGAGAGGACATGG + Intronic
1005026433 6:21466934-21466956 CCCTCAGCAGAGAGGGGAGCTGG - Intergenic
1005958807 6:30682496-30682518 GTTGCAGCAGAGCTGGGACAAGG + Intronic
1006409582 6:33864797-33864819 CTCTCAGCGGAGAGGGGAGCTGG - Intergenic
1008095679 6:47337067-47337089 CTTATAACAGAAAGGGGACAGGG + Intergenic
1008231634 6:48990399-48990421 CTCTCATCAGAGAGGAGACCTGG - Intergenic
1008248090 6:49203774-49203796 CTGTCAGCAGAGAGGGGAACTGG - Intergenic
1008745758 6:54667787-54667809 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1009307061 6:62103477-62103499 CTGGGAGCAGAGAGAGGACAGGG + Intronic
1009766158 6:68078766-68078788 ATTTAAGCAGAGAATGGACAGGG - Intergenic
1010294723 6:74182722-74182744 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1010490201 6:76466550-76466572 CTCTCAGCAAAGAGGGGATTTGG - Intergenic
1010570950 6:77474306-77474328 TTCTCAGCAAAAAGGGGACATGG - Intergenic
1010571523 6:77478605-77478627 TTCTCAGCAAAGAGGGGACATGG - Intergenic
1010581937 6:77610007-77610029 TTTTCAGCAGAGAGGTAACATGG + Intergenic
1010732365 6:79404593-79404615 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1011229095 6:85139847-85139869 TTTGAAGCAGAAAGGGGACATGG - Intergenic
1011233818 6:85193043-85193065 CTTTCAGCAGGAAGGGGAGCTGG - Intergenic
1012528183 6:100202592-100202614 CTTAAAGCAGAGAGGGGTCAGGG - Intergenic
1012758478 6:103264109-103264131 CTTTCACCAGTGAGGGCAAAGGG - Intergenic
1013398796 6:109770975-109770997 CTTTCAGCAGTGAGCAGAAAGGG - Intronic
1013438547 6:110138606-110138628 CTCTCAGCAGAGAAGAGACCAGG + Intronic
1013546239 6:111160724-111160746 CTCTCAGCATTAAGGGGACACGG + Intronic
1013950236 6:115771326-115771348 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1014107407 6:117582673-117582695 CTCTCAGCAGAGAGGGGAGCTGG - Intronic
1014485442 6:121993715-121993737 CTCTTAGCAGAGAGGGGATGCGG + Intergenic
1015308262 6:131734722-131734744 TTTTTAGTAGAGACGGGACAGGG - Intronic
1015353683 6:132252165-132252187 CTCTCAGCAGAGAGGGGGTGTGG - Intergenic
1015434777 6:133172925-133172947 CTCTCAGTAGAGAGGAGACCTGG - Intergenic
1015631319 6:135234838-135234860 CTTTGAGGCGAGAGGGGAGAAGG - Intergenic
1016082992 6:139878380-139878402 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1016190838 6:141261793-141261815 CTCTTAGCAGAGAGGAGACCTGG - Intergenic
1016828277 6:148407983-148408005 CTACCAGCAGGGAGGGAACAGGG + Intronic
1017946500 6:159100472-159100494 CAAGCAGCAGAGAGGGGCCAGGG - Intergenic
1018654772 6:166024757-166024779 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1018943620 6:168329146-168329168 TTTTGAGCAGAGAAGTGACAAGG - Intergenic
1019076855 6:169394841-169394863 TCTTCAGCAGAGAGGGAACATGG + Intergenic
1019104251 6:169656044-169656066 CTCTCAGCAGAGAGGGGACCCGG + Intronic
1019831810 7:3337801-3337823 CTTTCAGGAATGAGGGGAAAAGG + Intronic
1019897880 7:3997376-3997398 CTCTCAGCAGAGAGGAGGCCTGG + Intronic
1021210693 7:17848420-17848442 CCTTCATCAGTGAGGGCACAGGG - Intronic
1021235833 7:18141652-18141674 CTTTCAGAATAGCGGGGACACGG + Intronic
1021278831 7:18691169-18691191 CATTCAGGAGATAGGAGACATGG + Intronic
1021410157 7:20320968-20320990 CTATCTGCGGAAAGGGGACAGGG - Intergenic
1022272861 7:28827115-28827137 TTTTTAGCAGTGAGGGGACGTGG - Intergenic
1023092404 7:36629402-36629424 CATTCAACAGGGAGGGGGCAGGG + Intronic
1023181639 7:37490650-37490672 CTTTCAGCACAGTGAGGACTAGG + Intergenic
1023276255 7:38521880-38521902 ATTTCAGCAAAGAGTGTACATGG - Intronic
1023934497 7:44729863-44729885 CTCTCAGCTGAGAGGGGACTTGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024857012 7:53794288-53794310 CTCTCAGCAGAGAGGAGAACTGG + Intergenic
1025062580 7:55823372-55823394 CTCTCAGTGGAGAGGGGACCTGG - Intronic
1025618224 7:63142986-63143008 CTTTCAGTGGAGAGGGGACCTGG - Intergenic
1025623169 7:63193029-63193051 CTAGCAGCAGAGATGGTACAAGG + Intergenic
1025839931 7:65136670-65136692 CTTTTAGCAGAGATGGGATAGGG - Intergenic
1025883135 7:65559295-65559317 CTTTTAGCAGAGATGGGATAGGG + Intergenic
1025890311 7:65643311-65643333 CTTTTAGCAGAGATGGGATAGGG - Intergenic
1026946218 7:74317836-74317858 GTTTCCCCAGGGAGGGGACATGG + Intronic
1027687346 7:81294572-81294594 CTCTCAACAGAGAGGAGACCTGG + Intergenic
1027953532 7:84850796-84850818 GTTTATGCAGAGAGGGTACATGG + Intergenic
1027974828 7:85138808-85138830 CTGTCAGCAGGTAGGGGGCAGGG - Intronic
1028046821 7:86130705-86130727 CTTCCACCAGCGAGGGCACAGGG + Intergenic
1028052241 7:86202606-86202628 CCCTCAGCAGAGAGGAGACCTGG + Intergenic
1028054533 7:86225943-86225965 CCCTCAGCAGAGAGGAGACCTGG + Intergenic
1028115806 7:86996310-86996332 CTGTCAGCATAGAGGAGAAATGG + Intronic
1029678100 7:102085808-102085830 CTTTCAGCAAATAGAGGAAAGGG - Intronic
1029876739 7:103762189-103762211 CCTACAGCAGGGAGGGGAAAGGG - Intronic
1030384217 7:108848307-108848329 CTTTCAGCAGAGGGGGGATGTGG + Intergenic
1031667569 7:124503794-124503816 TTTTCAGCAGAGAGGAGATGGGG + Intergenic
1031852169 7:126878697-126878719 CTTTTAGCAGAGATGGGATAGGG + Intronic
1031877465 7:127158248-127158270 CTGTCAGCCTAGAGAGGACATGG + Intronic
1032466449 7:132148634-132148656 CTTTTGGCAGAGTGGCGACAAGG - Exonic
1033166474 7:139042805-139042827 CTTTCAGTGGAGAGGGAGCAGGG - Intergenic
1033928200 7:146489767-146489789 CTCTCAGCAGAGAAGGCACGTGG + Intronic
1034064067 7:148119621-148119643 ATTTCAGCAGAAATGGGAAATGG - Intronic
1034101769 7:148457044-148457066 CTCTCGGCAGAGAGGAGACCTGG + Intergenic
1034315846 7:150132192-150132214 TTTTCAGGAGCTAGGGGACAGGG + Intergenic
1034717365 7:153256013-153256035 CTCTCAGCAGAGAGGGGACGTGG - Intergenic
1034791046 7:153968609-153968631 TTTTCAGGAGCTAGGGGACAGGG - Intronic
1034922876 7:155098443-155098465 CTTTCTGAAGAGAGGGGACAAGG + Intergenic
1036697531 8:10987655-10987677 CTTTGAGCAGAGAAGAGACAGGG - Intronic
1037473006 8:19229115-19229137 CTCTCAGCAGAGAGGGGAACTGG + Intergenic
1038286008 8:26207026-26207048 CTGTCAGTAGAGAGGGGAGCTGG - Intergenic
1038429118 8:27485708-27485730 CTTTCAGCAGAGAGGGGACACGG + Intergenic
1038520353 8:28226985-28227007 CTCTCAGCAGAGAGGGAATGTGG - Intergenic
1038562950 8:28596424-28596446 CTCTCAGCAGAGAGGGGACACGG + Intergenic
1039787139 8:40843730-40843752 CATTCTGCAGAGAGTGGACAAGG - Intronic
1040580095 8:48690593-48690615 CTTTCAGCAGAGAGAGCGCAGGG - Intergenic
1040597404 8:48852850-48852872 CTGACAGCAGAGGGGGCACAAGG + Intergenic
1041131957 8:54710653-54710675 CTGTCAGCGGAGAGGGGAGCTGG + Intergenic
1041274437 8:56142683-56142705 CCCTCAGCAGAGAGGAGACCTGG - Intergenic
1041360606 8:57049526-57049548 CTTTCAGCAAAGAGAGGACATGG - Intergenic
1041978841 8:63831913-63831935 CTTTCAGCAGAGAGGGGACATGG - Intergenic
1042856189 8:73270540-73270562 CTTTCAGGAAGGAGGGGAGATGG + Intergenic
1042991675 8:74647206-74647228 ATTTCAGCAAAGAGGTGATATGG + Intronic
1043335808 8:79175534-79175556 CTTTCAGTAATGAGGGGTCAGGG - Intergenic
1043687558 8:83106880-83106902 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1044263910 8:90160595-90160617 CTCTCTGTGGAGAGGGGACATGG + Intergenic
1044594182 8:93942220-93942242 CTCTCAGTGGAGAGGAGACACGG + Intergenic
1044631023 8:94278697-94278719 CTCTCAGCAGAGAGGGGAGCTGG + Intergenic
1044724757 8:95184406-95184428 GGTTCAGCAGAGCGGGGAGATGG + Intergenic
1045803007 8:106123327-106123349 CTCTCAGTAGAGAGGGGAGCTGG + Intergenic
1046406244 8:113776140-113776162 CTCTTAGCAAAGAGGGGACATGG - Intergenic
1046451661 8:114400124-114400146 CTTTCAGCAGAAAGCTTACAAGG + Intergenic
1047537820 8:125735325-125735347 CTTTCAGCACAGAGGGAACACGG - Intergenic
1048010129 8:130448786-130448808 CTTTCTGCAGAGAAGGGAGTAGG + Intergenic
1048410648 8:134168892-134168914 CTCTCAGCAGAAAGGGGACATGG + Intergenic
1048547917 8:135404504-135404526 CCCTCAGCAGAGAGGAGACCTGG + Intergenic
1048843322 8:138583742-138583764 ATTTCGGAAGAGAGGGAACATGG - Intergenic
1049333891 8:142071754-142071776 CTCTGCGCAGAGAGGGGCCACGG + Intergenic
1049408496 8:142462098-142462120 CTTCCAGGAGGCAGGGGACATGG + Intronic
1049634827 8:143682057-143682079 CTTTCAGTGGAGAGGGGACATGG + Intergenic
1049824061 8:144655576-144655598 TTTTCAGCAGAGAGGAGGCCTGG - Intergenic
1049826811 8:144674363-144674385 GTCTCAGCAGAGAGGAGACTCGG + Intergenic
1050482060 9:6097535-6097557 CTTTCAGCAGAGAGAGGATGTGG - Intergenic
1050792831 9:9495644-9495666 CTCTCAGCAGAGAGGGGAGTCGG - Intronic
1050939709 9:11443343-11443365 CTGTCAGCAGAGAGGGGAGCTGG - Intergenic
1051355217 9:16234410-16234432 CCCTCAGCAGAGAGGAGACCTGG - Intronic
1051553442 9:18356123-18356145 CTTTCAGTGGATGGGGGACATGG + Intergenic
1052466767 9:28839479-28839501 CTCTCAGCAGAGAGGAGACCAGG + Intergenic
1052660172 9:31419337-31419359 CTCTCAGCAGATAGGGGAACTGG - Intergenic
1053476411 9:38385109-38385131 CTGTCAGCAGAGAGGGGATGTGG - Intergenic
1055135497 9:72824492-72824514 CTCTCAGCAGAGAGGGCAGTTGG + Intronic
1056081408 9:83097748-83097770 CTTTCTGCACACAGAGGACAGGG + Intergenic
1056271593 9:84953124-84953146 TTTTCAGCACTGAGGGGTCAGGG - Intronic
1056429830 9:86516371-86516393 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1056667242 9:88590480-88590502 CTCTCAGCAGAGAGTGGAACTGG - Intergenic
1058295693 9:103303805-103303827 CTCTCAGCAGAAAGGGGGCGTGG + Intergenic
1058317462 9:103586536-103586558 CTGTTAGCAGAGAGGGGAGCTGG - Intergenic
1058766820 9:108189916-108189938 CTGGCAGCAGGGAGGGGGCAGGG + Intergenic
1058868549 9:109183242-109183264 CTTACAGCAGGCAGGGTACAAGG + Intronic
1059104846 9:111502098-111502120 CCCTCAGCAGAGAGGAGACCTGG - Intergenic
1059466537 9:114472233-114472255 CTTTGAGCAGAGGAGGGACCAGG - Intronic
1059631871 9:116133638-116133660 CTTAAAGAAGAGAGGTGACATGG + Intergenic
1060542734 9:124441549-124441571 CTTGCAGCAGAGCCGGGCCAGGG - Intergenic
1060724371 9:125997405-125997427 CTCTGAGCAGAGAGGGGCCTGGG - Intergenic
1061182333 9:129032046-129032068 CTCTCAGCAGAGAGGTGAACTGG - Intergenic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1062013965 9:134282011-134282033 GGTTCAGCAGAAAGAGGACAAGG + Intergenic
1062257383 9:135633974-135633996 TCTTCAGCAGAAAGGGGACAGGG - Intronic
1062615922 9:137395632-137395654 CTTTCAGCAGGGAGGGCAGGGGG + Intronic
1186239001 X:7546463-7546485 CTCTCAGCAGAGAGGGAAGCTGG - Intergenic
1186780998 X:12911828-12911850 CTTTCGGCACAGAAGGCACAGGG + Intronic
1187998722 X:24957777-24957799 TTTTAAGCAGAGAAGGGGCATGG + Intronic
1188194965 X:27222309-27222331 CTCTCAACAGAGAGGAGACCTGG - Intergenic
1188495491 X:30779429-30779451 CTCTCAGCAGAGAGGGGAGCTGG - Intergenic
1189304383 X:39975618-39975640 CTCTCAGCAGACAGGGGAGGAGG - Intergenic
1189515713 X:41711855-41711877 CTTTCAGCAGAGAGGGGACACGG - Intronic
1189638242 X:43036360-43036382 GTTTCAGGAGAGAAGGGGCAAGG - Intergenic
1189736255 X:44072765-44072787 CTTTCAGTAGAGATGGTCCAAGG + Intergenic
1190621179 X:52288280-52288302 CCCTCAGCAGAGAGGAGACCTGG - Intergenic
1190621216 X:52288490-52288512 CCCTCAGCAGAGAGGAGACCTGG - Intergenic
1191754274 X:64577244-64577266 CTCTCAGCAGAGAGGGGACACGG - Intergenic
1192733780 X:73828745-73828767 CTTTCAGCAGAAAGCAGAAATGG + Intergenic
1193864616 X:86715796-86715818 CTTTAAGAAGAGAGGAGGCAGGG + Intronic
1195670528 X:107466179-107466201 CGTTCTGCAGAAATGGGACAGGG + Intergenic
1196769046 X:119274462-119274484 CCTTCAGCACAGAGGAGACCAGG + Intergenic
1196873142 X:120131510-120131532 CTTTCAGTGGAGAGGGGAGCTGG + Intergenic
1197397207 X:125941346-125941368 CTCTCAGCAGAGAGAGGATGTGG + Intergenic
1197777334 X:130127170-130127192 TTTTAAACAGGGAGGGGACATGG + Intergenic
1197793841 X:130280697-130280719 GTTTCACCAGAGAGTGGACCTGG - Intergenic
1198363418 X:135917498-135917520 CTCGCAGCAGAGAGGGGAGCTGG + Intergenic
1198454580 X:136803862-136803884 CTCTCAGCAGAGAGGAGAGCTGG + Intergenic
1198730433 X:139722170-139722192 CTTTGAACTGAGAGGGGAGAGGG - Intergenic
1199194574 X:145012918-145012940 ATTTCTGCAGAGGAGGGACAGGG - Intergenic
1199842023 X:151659104-151659126 TTTTAAGCAGAGAGGTGAAAAGG - Intronic
1200210361 X:154344374-154344396 CCTGGGGCAGAGAGGGGACAGGG - Intergenic
1200220491 X:154387718-154387740 CCTGGGGCAGAGAGGGGACAGGG + Intergenic
1200684938 Y:6249627-6249649 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200990468 Y:9340898-9340920 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200993130 Y:9361215-9361237 CTTACAGAAGTGAGGGGAAAGGG + Intronic
1200995784 Y:9381485-9381507 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200998448 Y:9401837-9401859 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201000958 Y:9470367-9470389 CTTACAGAAGTGAGGGGAAAGGG + Intronic
1201003625 Y:9490695-9490717 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201006281 Y:9510977-9510999 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201008939 Y:9531286-9531308 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201320509 Y:12693581-12693603 CTTTCAGTGGGGAGGGGACAAGG + Intergenic