ID: 1008753892

View in Genome Browser
Species Human (GRCh38)
Location 6:54770526-54770548
Sequence CAGGCACTGAAGGCGGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008753880_1008753892 14 Left 1008753880 6:54770489-54770511 CCGGCCTCCGCCATTTCGGACTG No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data
1008753885_1008753892 4 Left 1008753885 6:54770499-54770521 CCATTTCGGACTGGGAGCTCCGT No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data
1008753877_1008753892 23 Left 1008753877 6:54770480-54770502 CCAGTACTCCCGGCCTCCGCCAT No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data
1008753883_1008753892 10 Left 1008753883 6:54770493-54770515 CCTCCGCCATTTCGGACTGGGAG No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data
1008753884_1008753892 7 Left 1008753884 6:54770496-54770518 CCGCCATTTCGGACTGGGAGCTC No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data
1008753879_1008753892 15 Left 1008753879 6:54770488-54770510 CCCGGCCTCCGCCATTTCGGACT No data
Right 1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008753892 Original CRISPR CAGGCACTGAAGGCGGCGGC AGG Intergenic
No off target data available for this crispr