ID: 1008754471

View in Genome Browser
Species Human (GRCh38)
Location 6:54777741-54777763
Sequence CTACACAAAAAGATGGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008754471_1008754476 24 Left 1008754471 6:54777741-54777763 CCATGGTCCATCTTTTTGTGTAG No data
Right 1008754476 6:54777788-54777810 AATTAGCATGACCAAAATGAAGG No data
1008754471_1008754475 0 Left 1008754471 6:54777741-54777763 CCATGGTCCATCTTTTTGTGTAG No data
Right 1008754475 6:54777764-54777786 GGTAAGCAATGAAGAATATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008754471 Original CRISPR CTACACAAAAAGATGGACCA TGG (reversed) Intergenic
No off target data available for this crispr