ID: 1008758808

View in Genome Browser
Species Human (GRCh38)
Location 6:54829337-54829359
Sequence CACTGCCTGAATAAATTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008758808_1008758812 0 Left 1008758808 6:54829337-54829359 CCAGACAATTTATTCAGGCAGTG No data
Right 1008758812 6:54829360-54829382 CATGAGCTCGGATCACCTAGGGG No data
1008758808_1008758810 -2 Left 1008758808 6:54829337-54829359 CCAGACAATTTATTCAGGCAGTG No data
Right 1008758810 6:54829358-54829380 TGCATGAGCTCGGATCACCTAGG No data
1008758808_1008758811 -1 Left 1008758808 6:54829337-54829359 CCAGACAATTTATTCAGGCAGTG No data
Right 1008758811 6:54829359-54829381 GCATGAGCTCGGATCACCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008758808 Original CRISPR CACTGCCTGAATAAATTGTC TGG (reversed) Intergenic
No off target data available for this crispr