ID: 1008763186

View in Genome Browser
Species Human (GRCh38)
Location 6:54879005-54879027
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008763186_1008763189 3 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763189 6:54879031-54879053 TCATTTGAGGTTGGTGTCAGAGG No data
1008763186_1008763187 -10 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763187 6:54879018-54879040 AGTGATGGTATTGTCATTTGAGG 0: 1
1: 0
2: 2
3: 13
4: 226
1008763186_1008763196 29 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763196 6:54879057-54879079 CAAAGTTGGGATCAGGAAGCAGG 0: 1
1: 0
2: 2
3: 15
4: 214
1008763186_1008763190 15 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763190 6:54879043-54879065 GGTGTCAGAGGCCCCAAAGTTGG No data
1008763186_1008763188 -6 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763188 6:54879022-54879044 ATGGTATTGTCATTTGAGGTTGG 0: 1
1: 0
2: 1
3: 8
4: 205
1008763186_1008763192 22 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763192 6:54879050-54879072 GAGGCCCCAAAGTTGGGATCAGG No data
1008763186_1008763191 16 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763191 6:54879044-54879066 GTGTCAGAGGCCCCAAAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008763186 Original CRISPR TACCATCACTCCAACTGCTC AGG (reversed) Intronic