ID: 1008763188 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:54879022-54879044 |
Sequence | ATGGTATTGTCATTTGAGGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 215 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 8, 4: 205} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1008763186_1008763188 | -6 | Left | 1008763186 | 6:54879005-54879027 | CCTGAGCAGTTGGAGTGATGGTA | 0: 1 1: 0 2: 1 3: 11 4: 163 |
||
Right | 1008763188 | 6:54879022-54879044 | ATGGTATTGTCATTTGAGGTTGG | 0: 1 1: 0 2: 1 3: 8 4: 205 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1008763188 | Original CRISPR | ATGGTATTGTCATTTGAGGT TGG | Intronic | ||