ID: 1008763191

View in Genome Browser
Species Human (GRCh38)
Location 6:54879044-54879066
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008763186_1008763191 16 Left 1008763186 6:54879005-54879027 CCTGAGCAGTTGGAGTGATGGTA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1008763191 6:54879044-54879066 GTGTCAGAGGCCCCAAAGTTGGG 0: 1
1: 0
2: 0
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type