ID: 1008763196 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:54879057-54879079 |
| Sequence | CAAAGTTGGGATCAGGAAGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 232 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 15, 4: 214} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008763186_1008763196 | 29 | Left | 1008763186 | 6:54879005-54879027 | CCTGAGCAGTTGGAGTGATGGTA | 0: 1 1: 0 2: 1 3: 11 4: 163 |
||
| Right | 1008763196 | 6:54879057-54879079 | CAAAGTTGGGATCAGGAAGCAGG | 0: 1 1: 0 2: 2 3: 15 4: 214 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008763196 | Original CRISPR | CAAAGTTGGGATCAGGAAGC AGG | Intronic | ||