ID: 1008765471

View in Genome Browser
Species Human (GRCh38)
Location 6:54908165-54908187
Sequence TCAGAGTGGGTGCTGCGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008765468_1008765471 29 Left 1008765468 6:54908113-54908135 CCTTCTTGGGATTTCATGGAAAA 0: 1
1: 0
2: 5
3: 16
4: 248
Right 1008765471 6:54908165-54908187 TCAGAGTGGGTGCTGCGTAAAGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008765471 Original CRISPR TCAGAGTGGGTGCTGCGTAA AGG Intronic
900643628 1:3698834-3698856 ACAGAGTGGGTGCTGCAGACGGG + Intronic
901713739 1:11136405-11136427 TCAAAGTTGGTGGTGAGTAATGG - Intronic
901763217 1:11484107-11484129 TCAGAGGGGGTGCAGCGGAGAGG - Intronic
902732279 1:18377304-18377326 TCACAGCAGGTGCTGGGTAAAGG + Intronic
905066708 1:35191110-35191132 TGTTAGTGGGTGCTGCCTAAAGG - Intronic
906144600 1:43552460-43552482 GCAGAGTGGGTGCTTGGCAAAGG + Intronic
906648455 1:47492933-47492955 ACATAGTGGGTGCCCCGTAAGGG + Intergenic
911266860 1:95753498-95753520 TCAGAGTGGTTGCTGCGGGTAGG - Intergenic
912972576 1:114297825-114297847 GCAGAGTCGGTGCTGAATAACGG + Intergenic
913043370 1:115052078-115052100 TCTGAGCGTGTGCTGCATAATGG - Intronic
913576478 1:120180433-120180455 TCACAGTGCGAGCTGCGTGAAGG + Intergenic
914558384 1:148791871-148791893 TCACAGTGCGAGCTGCGTGAAGG + Intergenic
914614451 1:149338359-149338381 TCACAGTGCGAGCTGCGTGAAGG - Intergenic
1067545332 10:47188687-47188709 TGAGACTGGGAGCTGCATAAGGG + Intergenic
1069121727 10:64576632-64576654 TCAGAGTGGGTGCTGGGAGCAGG - Intergenic
1071250519 10:83814356-83814378 TCAGTGTGGGTGGTACATAATGG - Intergenic
1072569181 10:96643594-96643616 TCAGATTGGGTGCTCCTTTAGGG - Intronic
1073746985 10:106480280-106480302 TCAGAGTAGGTTCTGAGGAAGGG - Intergenic
1074425919 10:113351222-113351244 TCAGAGTGGGTCCAGCAGAAAGG - Intergenic
1076133507 10:128029351-128029373 TCACAGTGGGTGCTGGGTCAGGG - Intronic
1076609348 10:131711482-131711504 TCAGGGTGTGTGCCGTGTAACGG - Intergenic
1077917630 11:6621714-6621736 TCAGAGTGGGGCCTGCGTTGGGG + Exonic
1080718432 11:34825965-34825987 TCATTGTGTGTGCTGGGTAAAGG + Intergenic
1082711778 11:56561354-56561376 TCCCACTGGGTCCTGCGTAATGG + Intergenic
1084893527 11:72249528-72249550 TCAGAGTGGGTGCGGTTTGAGGG - Intergenic
1085800647 11:79586121-79586143 TCACACTGGGAGCTGCGGAATGG - Intergenic
1087442968 11:98208603-98208625 TCAGAGTGGGTGCTGGGAGCAGG + Intergenic
1091755616 12:3049532-3049554 TCAGAGTGGGTGGTCCTTGAAGG + Intergenic
1092194730 12:6542347-6542369 TCAGAGTGTGGGCTGCAGAATGG - Intronic
1093243068 12:16701440-16701462 TCGGAGTGGGTGCTGGGTGGTGG + Intergenic
1095160302 12:38906609-38906631 TCAGAGTGAGCGCTGCGTTTGGG + Intronic
1097862179 12:64528716-64528738 CCAGGGTGGGTGCTGGATAACGG + Intergenic
1098085399 12:66837177-66837199 TCATAGTGGGTACTCAGTAAAGG - Intergenic
1101858116 12:108461066-108461088 GCAGAGTGGGTGCTGGGTGTTGG - Intergenic
1103401218 12:120644264-120644286 TCATAGTGAGTGCTGGATAAAGG + Intronic
1104510824 12:129376233-129376255 TGAGACTGGGTGATGCATAAAGG + Intronic
1104866407 12:131958250-131958272 TCAGAGTGGGTGCAGGGGACAGG - Intronic
1104894022 12:132153150-132153172 TCCGGGTGGGTGCTGTGTAGAGG + Intergenic
1110201068 13:72851336-72851358 TCAGAGTGGGTGCTGGGAGTAGG - Intronic
1111464818 13:88594942-88594964 TCAGAGTGGGTGCTGGGAGCAGG + Intergenic
1112492624 13:99880944-99880966 TCAGAGAGGGTGCTGAGTTTGGG - Intronic
1113477228 13:110592762-110592784 TCAGACTGGGTTCTGCTTAGGGG - Intergenic
1113947024 13:114050116-114050138 TCAAGCTGGGTGCTGCGGAAGGG - Intronic
1116151330 14:41145620-41145642 TCAGAGTGGGTGCTGGGAGCAGG + Intergenic
1119916312 14:78405589-78405611 TTAGAGTGGATGCTGGGGAAGGG + Intronic
1120250659 14:82058894-82058916 TCAGAGTGGTGGCTGGGAAAAGG + Intergenic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1121658251 14:95614438-95614460 ACAGAATGGGTGCTGCTTACTGG + Intergenic
1121861022 14:97318322-97318344 TCAGCGTTGGTGCTGTGTAGGGG + Intergenic
1122139635 14:99654964-99654986 TCAGAGTGGGGGCTCAGCAAAGG + Intronic
1123966690 15:25466693-25466715 TCACAGTAGATGCTGCTTAATGG - Intergenic
1124910536 15:33915875-33915897 GCAGCGTGGGAGCTGGGTAAGGG + Intronic
1126404956 15:48314156-48314178 ACAGAGTGTGTGGTGCGTCAGGG - Intergenic
1135955385 16:26952526-26952548 TCAGAGTGAGTGCTGGGAACAGG - Intergenic
1137270855 16:46901524-46901546 CCAGCGTGGGTGCTGCATGAAGG - Intronic
1140891069 16:79285650-79285672 TCAGGGTGGTTTCTGAGTAATGG - Intergenic
1142230607 16:88898477-88898499 TGAGAGTGGGTGATCCCTAAGGG + Intronic
1142289406 16:89185965-89185987 GCAGAGTAGGTGCTCTGTAAAGG + Intronic
1142591327 17:1007343-1007365 TCCGAGTGGCTGCTGAGGAAGGG - Intronic
1157304947 18:46509919-46509941 GCAGAGGGGCTGCTGAGTAAAGG - Intronic
1160060109 18:75522051-75522073 TCTGGGTGGCTGCTGCGTCAGGG - Intergenic
1163640520 19:18459397-18459419 CCTGAGTGGGTGCTGCGTGCTGG + Intronic
1166212204 19:41314052-41314074 TCAGACTGGGTGCTCCCTGAGGG + Intronic
1166746081 19:45142488-45142510 GCAGAGTGGGTGCTGGGTGACGG - Intronic
1168619691 19:57868230-57868252 TCACTGTGGGTGCATCGTAAAGG - Intronic
931180070 2:59890780-59890802 AGAGAGTGAGTGCTGAGTAAAGG + Intergenic
932317280 2:70793552-70793574 TCAGAGTGGGAGCTGAAGAAGGG - Intergenic
934754347 2:96815497-96815519 TCAGCGTGGGTGCTGGGTTCCGG - Intergenic
937890872 2:126937584-126937606 TGAGTGTGGTTGCTGCGTAGAGG - Intergenic
938498696 2:131818526-131818548 GCAGAGTGGGTGCTTCCTGAAGG - Intergenic
939529093 2:143335221-143335243 TCAGAGTTGGTGCTGGCTATAGG - Intronic
947091830 2:226520795-226520817 TCAGACTGGGTGCTTCATGAAGG + Intergenic
948684247 2:239660118-239660140 CCAGAGTGGGGGCTGTGTGAAGG - Intergenic
1169080996 20:2797735-2797757 ACAGGGTGGGTGCTGCTTCACGG - Intronic
1170283941 20:14684215-14684237 TCTGACTGGGTGCTGCGCAAGGG - Intronic
1170783476 20:19447878-19447900 ACAGAGTGGGTACTTCGTGAAGG + Intronic
1171118890 20:22550970-22550992 TCAGAGTGGGTGAGGGGTAAGGG - Intergenic
1173920049 20:46737574-46737596 TCATAGTGGGTGCTCCTAAATGG + Intergenic
1175065032 20:56277178-56277200 TCAGAGTGGGTGCTGGGAGCAGG - Intergenic
1178526312 21:33332042-33332064 TCAGAGTGGCTACTGGGCAAAGG - Intronic
1180701156 22:17782079-17782101 TCAGAATGGGTGCTGGGGCAGGG + Intergenic
1183305353 22:37080123-37080145 TGAGAGTGGCTTCTGCGAAATGG + Intronic
1185070825 22:48654782-48654804 GCAGAGTGGGTGCTGGATCAAGG - Intronic
1185395835 22:50587464-50587486 GTAGCGTGGCTGCTGCGTAACGG + Intronic
950659849 3:14460545-14460567 TCAGACTGGGTGCTCCCCAAGGG - Intronic
953104994 3:39868775-39868797 TCAGTGTGAGAGCTCCGTAAAGG - Intronic
953741982 3:45546057-45546079 ACAGAGGGGGTGCTGGGTGAGGG - Intronic
954618735 3:51983898-51983920 ACAGAATGGGTGCTCCTTAATGG + Intronic
959748300 3:109803565-109803587 TCTGAGTGGGTGCTGCTGCATGG - Intergenic
964159643 3:153631459-153631481 TCAGACTGGGAGCTCCTTAAGGG + Intergenic
969336582 4:6513841-6513863 TCAGAGTGGGTGCTCCCCACTGG - Intronic
977996850 4:103504978-103505000 TCAAAGTGGGTCCTGCCTAGTGG + Intergenic
983897312 4:173095495-173095517 TCAGAGTGGGTACAGAGGAAAGG - Intergenic
985769461 5:1799728-1799750 TGAGAGTGGGGGCTGCGAGAGGG - Intronic
988474122 5:31567616-31567638 ACAGAGTGAGTGCTGAGCAAAGG - Intergenic
990876615 5:60493770-60493792 TCATGGTGGGTGCTGGGGAAGGG - Intronic
991959840 5:72033700-72033722 GCAGAGTGGGTGCTGGGAAGAGG + Intergenic
992838996 5:80668611-80668633 TCAGAGTGGGTGCTGGGAGCTGG + Intronic
994104956 5:95937205-95937227 TCACAGTGGGGCCTGTGTAAGGG + Intronic
998424820 5:142017573-142017595 TCAAAGTGGGTGCTGCGGGTTGG + Intergenic
1000190643 5:158907172-158907194 TTAGAGTGACTGCTGCGTGAAGG - Intronic
1002533389 5:179862890-179862912 ACAGAGTGGGCGCTGCGCACAGG - Exonic
1002953095 6:1835141-1835163 ACAGAGTCTGTGTTGCGTAAGGG + Intronic
1006609247 6:35283689-35283711 GCAGAGTGGGTACTGCTTCAAGG - Intronic
1008765471 6:54908165-54908187 TCAGAGTGGGTGCTGCGTAAAGG + Intronic
1010760416 6:79716177-79716199 ACAGAGTGGCTGCAGGGTAAGGG + Intergenic
1018607699 6:165615776-165615798 TCACAGTGGATGCTGTGTGACGG - Intronic
1018766624 6:166938669-166938691 ACAGAGTGGGTGCAGAGTATTGG - Intronic
1018862473 6:167721000-167721022 TCACAGCGGGTGCTGGGAAATGG - Intergenic
1023298747 7:38744853-38744875 TGAGAGTGAGTGCTGTATAAGGG + Intronic
1024445243 7:49470245-49470267 TCTGAGTAGGTGCTGCTTACAGG + Intergenic
1029690107 7:102175602-102175624 TCAGGGTGGGTGCCGGGGAAGGG - Intronic
1035100262 7:156390482-156390504 TCAGAGGTGGTGCTGTGTGATGG - Intergenic
1040389538 8:46937904-46937926 TCAGAGTGGGGGCTGATTTAGGG + Intergenic
1041955978 8:63558607-63558629 TCAGAGTGGGTGCTGGGAGCAGG - Intergenic
1043295974 8:78664753-78664775 CTAGACTGGGTGCTGCGGAAAGG - Intergenic
1048048256 8:130793247-130793269 TCAGAGAGGGTTCTGAGAAAGGG - Intronic
1051553651 9:18358505-18358527 TGAGAGTGACTGCTGCTTAATGG - Intergenic
1054648862 9:67610900-67610922 AGAGGGTGGGTGCTGCGAAAAGG - Intergenic
1057600720 9:96454827-96454849 TCACAGTGGGGGCTGCGTGGTGG + Intronic
1057780250 9:98044072-98044094 TCAAAGTGTGTGCTGCTTGAGGG + Intergenic
1061878678 9:133557538-133557560 TGAGAGGGGGTCCTGGGTAAAGG + Intronic
1062673972 9:137729068-137729090 TCAGAGTGAGCGCTGCGTCAGGG + Intronic
1186328642 X:8508348-8508370 TGAAAGTGGGTTCTGCATAATGG + Intergenic
1189318068 X:40069706-40069728 TCAGAGTGGGGGCTGCGAGTTGG + Intronic
1190681669 X:52831363-52831385 TCAGAGTGGGTGCTGAGAGCAGG - Intergenic
1201433664 Y:13932597-13932619 TGAAAGTGGGTTCTGCATAATGG - Intergenic