ID: 1008765604

View in Genome Browser
Species Human (GRCh38)
Location 6:54910152-54910174
Sequence CCATCTATGAAACAGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008765604_1008765608 6 Left 1008765604 6:54910152-54910174 CCACCTAGCTGTTTCATAGATGG No data
Right 1008765608 6:54910181-54910203 CTCAGCGACCCAAAGCCAGATGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008765604 Original CRISPR CCATCTATGAAACAGCTAGG TGG (reversed) Intronic