ID: 1008765604

View in Genome Browser
Species Human (GRCh38)
Location 6:54910152-54910174
Sequence CCATCTATGAAACAGCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008765604_1008765608 6 Left 1008765604 6:54910152-54910174 CCACCTAGCTGTTTCATAGATGG 0: 1
1: 0
2: 1
3: 19
4: 350
Right 1008765608 6:54910181-54910203 CTCAGCGACCCAAAGCCAGATGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008765604 Original CRISPR CCATCTATGAAACAGCTAGG TGG (reversed) Intronic
903449252 1:23441716-23441738 CCATCTTGGAAAAAGCTAAGAGG + Exonic
903737540 1:25539722-25539744 CCATCTATGAACCAGGAAGCCGG - Intergenic
905841729 1:41186247-41186269 CCATCTGTAAAAAAGGTAGGTGG + Intronic
908158925 1:61386914-61386936 CCATCTATGAACCAGGAAGTGGG - Intronic
908809614 1:67966586-67966608 CCATCTATGAACCAGAAAGTGGG + Intergenic
908814560 1:68018368-68018390 CCATCTATGAACCAGGAAGCAGG + Intergenic
908959794 1:69682631-69682653 CCATCTATGAACCAGAAAGCGGG + Intronic
909103452 1:71379475-71379497 CCACCTATGAACCAGCTAGTGGG + Intergenic
909292499 1:73901672-73901694 CCATGTATGATCCATCTAGGTGG - Intergenic
909301696 1:74020844-74020866 CCATCTATGAACCAGGAAGCAGG - Intergenic
909963129 1:81873110-81873132 CCATCTTGGAAATAGGTAGGTGG - Intronic
910253476 1:85222484-85222506 CCATCTATGAACCAGAAAGTGGG - Intergenic
910284809 1:85541849-85541871 CCATCTATGAACCAGGAAGCAGG + Intronic
910315514 1:85878272-85878294 CCATCTATGAAGCAGCAAGTGGG - Intronic
910318244 1:85913999-85914021 CCATCTATGAACCAGGGAGCAGG - Intronic
910548209 1:88444312-88444334 GCATTTATCAAACACCTAGGAGG + Intergenic
911345794 1:96695276-96695298 CCATCTATGAATCAGCAAACAGG + Intergenic
912667602 1:111596702-111596724 CCATCTATGAACCAGGAAGTGGG - Intronic
912720896 1:112019048-112019070 CCATCTATGAACCAGGAAGTGGG + Intergenic
914437668 1:147674015-147674037 CCAGCTATGAAACATGTAAGAGG + Intergenic
915781348 1:158554293-158554315 CCATCTTTGATAAAGCTAGGTGG - Intergenic
918447865 1:184632820-184632842 CCATCAATGAATCAACAAGGTGG - Intergenic
921126467 1:212182407-212182429 CCATCTATGAACCAGGAAGCAGG - Intergenic
922218195 1:223538099-223538121 CCCTCTATGAACCAGGAAGGGGG - Intronic
923394978 1:233552823-233552845 CCATCTATGAACCAGGGAGCAGG + Intergenic
1062801844 10:386832-386854 CCACATATGAAACAGATGGGGGG + Intronic
1063802279 10:9594024-9594046 CCATCTATGAAATAGAAAGCAGG - Intergenic
1063992005 10:11576560-11576582 CCATCTATGAACCAGAAAGCAGG + Intronic
1065792298 10:29271965-29271987 CCATCTATGAACCAGGAAGCAGG + Intergenic
1066082877 10:31949567-31949589 CCATCTATGAATCAGAAAGTGGG - Intergenic
1066133794 10:32422608-32422630 CCATCTATGAACCAGGAAGCAGG - Intergenic
1066704067 10:38158379-38158401 CCATTTATGAAACAACAAAGAGG - Intergenic
1066986549 10:42473501-42473523 CCATTTATGAAACAACAAAGAGG + Intergenic
1067977537 10:51042923-51042945 CCATCTATGAACCAGGAAGTAGG + Intronic
1068659076 10:59604695-59604717 CCATTTATGAACCAGCAAGTGGG + Intergenic
1069747545 10:70725526-70725548 CCATCTATGAACCAGAAAGTGGG - Intronic
1070315146 10:75303201-75303223 CCACCTATGAAATGGCTTGGAGG - Intergenic
1070530117 10:77329467-77329489 CCATCTATGAACCAGAAAGCAGG + Intronic
1070532481 10:77349283-77349305 CCATCTATGAACCAGACAGCGGG + Intronic
1070578925 10:77704108-77704130 CCATCTATGAACCAGCAAGCAGG + Intergenic
1071899143 10:90100350-90100372 CCATCTATGAATCAGGAAGCAGG - Intergenic
1072156020 10:92724368-92724390 CCATCTATGAACCAGAAAGTGGG - Intergenic
1072548753 10:96460882-96460904 CCATCTATGAACCAGGAAGCAGG + Intronic
1077646853 11:3932755-3932777 CCATCTATGAACCAGTAAGCGGG + Intronic
1077756948 11:5041640-5041662 CTACCTATGAAAGTGCTAGGTGG - Intergenic
1077805447 11:5587512-5587534 CCATCTATGAATCAGAAAGTGGG - Intronic
1078697034 11:13644651-13644673 CCATCAAGGGAACAGCAAGGGGG + Intergenic
1078711058 11:13791533-13791555 CCATCTATGAACCAGGAAGCAGG + Intergenic
1080585246 11:33675825-33675847 CCATCTATGAACCAGGAAGCGGG + Intergenic
1080659176 11:34282110-34282132 CCATCTATGAACCAGAAAGCAGG - Intronic
1085583602 11:77678827-77678849 CCATCTATGAACCAGAAAGCAGG + Intronic
1086501706 11:87460509-87460531 CCATTTATGAAACTGCTAACTGG + Intergenic
1088361014 11:108990072-108990094 CCATCTATGAACCAGAAAGTGGG + Intergenic
1088823940 11:113477960-113477982 CCATCTATGAAACAGAAAGCTGG - Intergenic
1090052476 11:123391833-123391855 ACATCTATGAAAGAGGCAGGTGG + Intergenic
1091114277 11:132998802-132998824 CCATCTATGAACCAGGAAGTAGG + Intronic
1093083332 12:14838953-14838975 CCCTCCATGAAATGGCTAGGTGG + Intronic
1094478554 12:30861621-30861643 CCATCTATGAATCAGAAAGCAGG - Intergenic
1094827481 12:34281750-34281772 CTATCTGTGAAACTGCTATGTGG - Intergenic
1095084316 12:38044853-38044875 CTATCTGTGAAACAGCTTTGTGG + Intergenic
1097703094 12:62840208-62840230 TCATCTATGAACCAGAAAGGGGG - Intronic
1097833030 12:64245569-64245591 CCATCTATGAACCAGGAAGCAGG + Intergenic
1101646827 12:106638736-106638758 CCATCTATGAACCAGAAAGTGGG - Intronic
1103678040 12:122672093-122672115 GCAACTAAGAAACAGCTACGTGG + Intergenic
1104565722 12:129879612-129879634 ACAACTCTGAAACACCTAGGGGG + Intronic
1106820282 13:33456772-33456794 CCATCTATGAACCAGAAAGCAGG + Intergenic
1106829979 13:33570210-33570232 GCATCTATGAAAGAGCACGGGGG + Intergenic
1107066404 13:36217996-36218018 CCATCTATGAACCAGGAAGTGGG + Intronic
1107095143 13:36527801-36527823 CCATCTGTGAAACAGGAGGGGGG - Intergenic
1107257945 13:38453194-38453216 CCAGCTATGAAAGACCTAGATGG - Intergenic
1107957517 13:45530766-45530788 CCATCTATGGAACAGGTAATGGG + Exonic
1110113997 13:71788260-71788282 CAATCTATGAAACAAAGAGGTGG + Intronic
1110548367 13:76782428-76782450 CCATCTATAAACCAGCAAGTGGG + Intergenic
1112118100 13:96379420-96379442 CCATCTATGAACCAGGAAGCAGG + Intronic
1112799114 13:103091277-103091299 CCATCTATGAACCAGAAAGCCGG + Intergenic
1112841500 13:103584854-103584876 CCATCTATGAACCAGGAAGCGGG - Intergenic
1113374444 13:109751071-109751093 CCATCTATGAAGCAGGCAGCAGG + Intergenic
1114381239 14:22206599-22206621 CCATCTATGAACCAGGAAGCAGG + Intergenic
1114831343 14:26145741-26145763 CCATCTATGAACCAGGAAGTGGG + Intergenic
1115986126 14:39104883-39104905 CCATCTATGAATCAGAAAGCAGG - Intronic
1116343649 14:43759342-43759364 CCATTTATGAACCAGCAAGCAGG + Intergenic
1116585363 14:46696815-46696837 CCATCTATGAACCAGGAAGGAGG - Intergenic
1116780357 14:49230264-49230286 CCTTTTATGAAACAGCTTAGTGG + Intergenic
1117144926 14:52827778-52827800 CCATCTATGAACCAGACAGCAGG + Intergenic
1118378808 14:65201036-65201058 CCATCTATGAACCAGAGAGTGGG + Intergenic
1119001712 14:70888085-70888107 CCATCTATGAACCAGGTAACAGG - Intergenic
1120087650 14:80293292-80293314 CCATCTATGAACCAGGAAGCAGG - Intronic
1120192562 14:81452462-81452484 CCATCTGTGAAACAGAAAGTGGG + Intergenic
1121081411 14:91111636-91111658 CCATCTATGAATCAGAAAGTAGG - Intronic
1121277897 14:92680124-92680146 CCATCTATGAACCAGAAAGTGGG - Intronic
1121778772 14:96608403-96608425 CCTTCTATGAATCAGCAAGTGGG - Intergenic
1124706749 15:31972972-31972994 CCATCAATGAAACAGTAAGTGGG - Intergenic
1125981515 15:44006036-44006058 CCATCTATGAAAGTCCTAGATGG - Intronic
1126437380 15:48649220-48649242 GGATCTATCATACAGCTAGGGGG - Intergenic
1126644647 15:50862731-50862753 CCATCTATGAACCAGGAAGCAGG + Intergenic
1126918415 15:53492129-53492151 CCATCTATGAACCAGGAAGCAGG - Intergenic
1128502014 15:68233282-68233304 CAATGTATGAAACACCTACGGGG + Intronic
1133912634 16:10079639-10079661 CCATCTATGAAAAAGGAAGCAGG + Intronic
1134195253 16:12154758-12154780 CCATCTATGAACCAGCAAACAGG - Intronic
1135043130 16:19133179-19133201 CCATCTGTGAAACAGGAAGTGGG + Intronic
1135137566 16:19896212-19896234 GCATCTGTGAACCAGCAAGGAGG + Intergenic
1135966120 16:27036652-27036674 CCATCTATGAAGGGGCAAGGAGG - Intergenic
1136739625 16:32505094-32505116 CCATCTGTGAAACCGCTTTGTGG - Intergenic
1137292770 16:47063150-47063172 CCATCTATGAACCAGGAAGAGGG + Intergenic
1139122319 16:64035410-64035432 CCATCTATGAACCAGAGAGAAGG - Intergenic
1139290803 16:65856121-65856143 CCATCTGAGAAACAGGGAGGAGG + Intergenic
1139336451 16:66235071-66235093 CCATCTATGAACCAGGAAGGGGG + Intergenic
1203013288 16_KI270728v1_random:322243-322265 CCATCTGTGAAACCGCTTTGTGG + Intergenic
1203031623 16_KI270728v1_random:595402-595424 CCATCTGTGAAACCGCTTTGTGG + Intergenic
1203040098 16_KI270728v1_random:739029-739051 CCATCTGTGAAACCGCTTTGTGG - Intergenic
1144457017 17:15427042-15427064 CCATCTATGAACCAGAAAGCAGG + Intergenic
1145103100 17:20093221-20093243 CCATCTATGAACCAGACAGCAGG - Intronic
1146816340 17:35944980-35945002 CCATGTTTGCCACAGCTAGGGGG - Intergenic
1149178932 17:53910851-53910873 CCACCTATCAACCAGATAGGTGG - Intergenic
1149216857 17:54366264-54366286 CCATCTATGAACCAGAAAGTGGG + Intergenic
1151229689 17:72675327-72675349 CCATCTACGAACCAGCAAGTGGG + Intronic
1152268067 17:79307665-79307687 CCATCTGAGAACCAGCTCGGGGG + Intronic
1153273013 18:3341889-3341911 CCATCTATGAAGCAGAGAGCAGG - Intergenic
1155724371 18:29061014-29061036 CCATCTATGAACCAGAAAGTGGG + Intergenic
1156525966 18:37767700-37767722 CCATCTATGAACCAGGAAGCAGG - Intergenic
1157423327 18:47564016-47564038 CCATCTATGAACCAGGAAGCAGG + Intergenic
1158620406 18:59027891-59027913 CCATCTATGAACCAGAAAGTGGG + Intergenic
1158743910 18:60175513-60175535 CCATCTATGAACCAGAAAGCAGG - Intergenic
1159012538 18:63071622-63071644 CCATCTATGAACCAGAAAGTGGG - Intergenic
1159566477 18:70056652-70056674 CTATCCAAGAAACAGCAAGGAGG - Intronic
1159595377 18:70378095-70378117 CCGTCTATGAAACAGGAAGCAGG - Intergenic
1162010618 19:7811744-7811766 CCATCTATGAATCAGGAAGCAGG + Intergenic
1164490695 19:28711327-28711349 CCTTCTTTGAATCAGCTAGAGGG + Intergenic
1164579347 19:29424930-29424952 CCATCTATGAATCAGCAAGAGGG - Intergenic
925833791 2:7923077-7923099 CCATCTATGAACCAGGAAGCAGG - Intergenic
926527968 2:14006593-14006615 CCATCTATGAACCAGGAAGTGGG + Intergenic
926813703 2:16779558-16779580 CCATCTATGAATCAGAAAGCAGG + Intergenic
927292980 2:21422620-21422642 ACATCTATGAAACAGGAAGCGGG + Intergenic
932855711 2:75232168-75232190 CCATCTATGAACCAGGAAGTAGG - Intergenic
934021408 2:87957490-87957512 CCATCTATGAACCAGGAAGTGGG - Intergenic
935448421 2:103181342-103181364 CCATCCATGAACCAGCAAGCAGG - Intergenic
935572541 2:104677039-104677061 CCATTTATGAACCAGTAAGGAGG - Intergenic
935607030 2:104981728-104981750 CCATCTATAAATCAGGAAGGAGG - Intergenic
935608283 2:104993034-104993056 CCATCTATGAAAGTCCTAGATGG - Intergenic
936619451 2:114080381-114080403 CCATCTATGAAACAGGAAAAGGG - Intergenic
936758465 2:115744005-115744027 CTATCTATGTAACAGCTCAGTGG - Intronic
937462522 2:122101760-122101782 CCATCTATGAACCAGGAAGTGGG - Intergenic
938933797 2:136111215-136111237 CCATCTATGAACCAGAAAGTGGG - Intergenic
938993726 2:136655887-136655909 CCAAAAAGGAAACAGCTAGGAGG - Intergenic
939083745 2:137692381-137692403 CAATCTAAGAGACAGCAAGGCGG - Intergenic
939103499 2:137923401-137923423 ACATTTATCAAACAGCTAGTAGG + Intergenic
943313865 2:186361112-186361134 CCATCTATGAACCAGGAAGCAGG + Intergenic
944016670 2:195048523-195048545 CCATCTATAAAACTGTTAGGTGG - Intergenic
944545623 2:200796404-200796426 CCATCTGTGAACCAGAGAGGAGG + Intergenic
944965493 2:204927388-204927410 CCATCTATGAACCAGAAAGCAGG + Intronic
945664623 2:212725418-212725440 CCATCTATGAACCAGGAAGCAGG - Intergenic
946548495 2:220774471-220774493 GCATCTATGAATCAGAAAGGGGG - Intergenic
946678967 2:222193790-222193812 CCATCTATGAAACAGGAAACAGG - Intergenic
946782064 2:223202112-223202134 CCATCTATGAACCAGGAAGTAGG - Intergenic
947099905 2:226608746-226608768 CCGTCTATGGACCACCTAGGAGG - Intergenic
1168884151 20:1233614-1233636 CCATCTATGAATCAGGAAGCAGG - Intronic
1169607967 20:7344707-7344729 CCATCTATGAACCAGAAATGTGG + Intergenic
1169988082 20:11469351-11469373 CCATCTATGACACAGGTGGCAGG + Intergenic
1170269128 20:14504181-14504203 CCATCTGTCCAACAGCTAGTTGG - Intronic
1170499167 20:16957102-16957124 CCACCTATGAAACAGAAAGCAGG + Intergenic
1170552497 20:17489809-17489831 CCATCTATGAACCAGGAAGTGGG - Intergenic
1170742403 20:19069521-19069543 CCATCTATGAACCAGGAAGAGGG + Intergenic
1173186211 20:40842530-40842552 CCATGTATGAAACAGCAGGAAGG - Intergenic
1173435300 20:43027141-43027163 CCTTCTCTGCAACAGCTTGGAGG - Intronic
1174144542 20:48442243-48442265 CCATCTATGAATCAGAAAGCAGG - Intergenic
1174184114 20:48693483-48693505 CCATCTATGAAGCAGAAAGCAGG + Intronic
1177783337 21:25642936-25642958 CCATCTATGAACCAGGAAGTGGG - Intronic
1177841182 21:26235665-26235687 CCATATATGAAAGAGATGGGTGG - Intergenic
1178096233 21:29218704-29218726 GCATCTATAAAGCAGGTAGGTGG - Intronic
1178733617 21:35129320-35129342 CCATCTATGAACCAGGAAGTGGG - Intronic
1178969749 21:37162861-37162883 CCATCTATGAACCAGAAAGCAGG - Intronic
1181453263 22:23038033-23038055 GCACCTATGAGACAGCCAGGTGG + Intergenic
1183337993 22:37261682-37261704 CCATCTATGAACCAGAAAGCAGG + Intergenic
1183941634 22:41298947-41298969 CCATCTATAAACCAGGAAGGCGG - Intergenic
1184290207 22:43494869-43494891 CCATCTATGAACCAGGAAGTGGG - Intronic
1184495812 22:44840776-44840798 CCATCTATGAACCAGGAAGCAGG - Intronic
1185201818 22:49511528-49511550 CCATCTATGAACCAGGAAGCGGG + Intronic
949264470 3:2140492-2140514 CCATCTATGAACCAGGAAGTGGG - Intronic
949589555 3:5479654-5479676 CCATCTGGGAAACTGTTAGGAGG - Intergenic
952509826 3:34041867-34041889 CCATCTATGAACCAGAAAGTGGG + Intergenic
952894618 3:38069799-38069821 CCATCTGTGAAACAGCTGGTGGG - Intronic
953242342 3:41160696-41160718 CCATCTATGAACCAGGAAGCAGG + Intergenic
953747789 3:45588200-45588222 CCATCTATGAACCAGAGAGCAGG + Intronic
954517412 3:51191015-51191037 CCAACTATGTAAGAGCTGGGTGG - Intronic
955040105 3:55308202-55308224 TCATCTATGAACCAGCCAGCAGG - Intergenic
955708113 3:61749796-61749818 CCTTCTATGAAAGAGCTTGGAGG + Intronic
956820097 3:72946557-72946579 CCATCTATGAATCAGGAAGCAGG - Intronic
957941309 3:87007850-87007872 CCATCTATGAACCAGAGAGCAGG + Intergenic
958156654 3:89763092-89763114 TCATCTATGAACCAGATAGCAGG + Intergenic
958567116 3:95828525-95828547 CCATCTATGAACCAGGAAGTGGG + Intergenic
959865043 3:111257204-111257226 CCATCTATGAATCAGGAAGTGGG - Intronic
960143423 3:114173161-114173183 CCATCTATGAACCAGAAAGCAGG + Intronic
960292862 3:115907420-115907442 CCATCTATGAAGCAGAGAGTGGG + Intronic
960306333 3:116066133-116066155 CCATCTATGAACCAGGAAGTGGG - Intronic
961436113 3:126917840-126917862 CCATCTATGAATCAGAAAGTGGG + Intronic
963803785 3:149702708-149702730 CCATCTATGAAATAACAAGTAGG + Intronic
965210656 3:165782788-165782810 CCATCTATGAACCAGAAAGCAGG - Intronic
965265455 3:166537220-166537242 CCATAGATGACACAGCTAGAAGG - Intergenic
965767143 3:172142893-172142915 CCATCTATGAACCAGAAAGCAGG - Intronic
965810126 3:172583118-172583140 CCATCTATGAACCAGAGAGCAGG - Intergenic
965928204 3:174009102-174009124 CCATCTATGAACCAGGAAGCAGG - Intronic
967936236 3:194730069-194730091 CCATCCATGTAAAAGCTATGTGG + Intergenic
970866243 4:20762159-20762181 CCATCTATGAACCAGGAATGTGG - Intronic
970974026 4:22022248-22022270 CCATCTATGAACCAGGAAAGAGG + Intergenic
971118032 4:23670410-23670432 CCATCTATGAACCAGGAAGCAGG - Intergenic
971390439 4:26180506-26180528 CCATCTATGAAGCAGGAAGTGGG - Intronic
971974962 4:33672948-33672970 CCATCTATAAATCAGCAAAGCGG - Intergenic
972174717 4:36389184-36389206 CTATTTGAGAAACAGCTAGGGGG + Intergenic
972239698 4:37177272-37177294 CCCTCTATGAACCAGCAAGCAGG - Intergenic
972414110 4:38821760-38821782 CCATCTATGAACCAGAAAGTGGG + Intronic
972768649 4:42175003-42175025 CCATCTATGAACCAGAAAGTGGG - Intergenic
973722858 4:53742843-53742865 CCATCTATGAACCAGGAAGTGGG - Intronic
974096313 4:57368424-57368446 CCATCTATGAAGCAGAGAGTAGG - Intergenic
974365758 4:60946904-60946926 CCATCTATAAACCAGCAAGTGGG - Intergenic
975474422 4:74806766-74806788 CCTTCTATGGAATAGCTAGGTGG - Intergenic
975713936 4:77187729-77187751 CCATCTATGAACCAGGAAGTGGG + Intronic
975980644 4:80154798-80154820 CCATCTATGAAACAGAAAGGAGG + Intergenic
977437873 4:97022919-97022941 CCATCTATGAAGCAGGAAGTGGG + Intergenic
978029324 4:103919716-103919738 CCATCTATGAACCAGGAAGCAGG + Intergenic
978833395 4:113116801-113116823 ACCTCTGTGAAACTGCTAGGGGG - Intronic
979531674 4:121774831-121774853 CCATCTATGAACCAGGAAGTGGG + Intergenic
980662329 4:135878613-135878635 CCATCTATGAACCAGAAAGAGGG + Intergenic
980797601 4:137704614-137704636 CCATCTATGAAGCAGGAAGCAGG + Intergenic
982408462 4:155045940-155045962 CCATCTATGAAACAGGAAATGGG + Intergenic
982780200 4:159482618-159482640 CCATCTATGAACCAGGAAGGGGG - Intergenic
982882315 4:160734837-160734859 CCATCTATGAACCAGGTGGCAGG + Intergenic
983124625 4:163935308-163935330 CTAGCTATGAAAGACCTAGGTGG + Intronic
983268251 4:165530562-165530584 CCATCTATGAGACAGAAAGTGGG - Intergenic
983514073 4:168638649-168638671 CCATCTATGAACCAGAAAGTGGG - Intronic
983838809 4:172429011-172429033 CCATCTATGAACCAGAAAGCGGG - Intronic
984288371 4:177762366-177762388 CCATGTATGAGCCAGATAGGAGG + Intronic
986610165 5:9559105-9559127 CCCACGATGAAACAGCTAGGAGG + Intergenic
986768782 5:10952628-10952650 CCATCTATGAACCAGGAAGCAGG + Intergenic
986864536 5:11970825-11970847 CCATCTATGAAGCAGGAAGTGGG + Intergenic
988178899 5:27764408-27764430 CCATCTATGAACCAGAGAGTGGG - Intergenic
988833232 5:35007201-35007223 CCATCTATGAACCAGAAAGTGGG + Intronic
989446636 5:41537376-41537398 CCATCTATGAACCAGAAAGTAGG - Intergenic
990481633 5:56216979-56217001 CCAGCTATGAAAGTCCTAGGTGG - Intronic
990536396 5:56727469-56727491 CCATCTATGAACCAGAAAGGAGG - Intergenic
991061136 5:62377693-62377715 CCATTTGTGAAACAGCTTCGTGG - Exonic
991919356 5:71639212-71639234 CCAGCTATGAAAGTCCTAGGTGG + Intronic
991953701 5:71971692-71971714 CCATCTATGAACCAGAAAGCAGG - Intergenic
992070538 5:73144640-73144662 CCATCTATGAATCAGGAAGTTGG + Intergenic
992212875 5:74497521-74497543 CCATCTATGAACCAGGAAGAGGG + Intergenic
993482325 5:88439044-88439066 CCATCTATGAAGCAGGAAGCAGG - Intergenic
994719634 5:103366007-103366029 CCATCTATGAACCAGGAAGTGGG - Intergenic
994729968 5:103480512-103480534 CCATCTATGAACCAGGAAGTGGG + Intergenic
995568107 5:113452511-113452533 CCATCTATGAACCAGGAAGCAGG + Intronic
995802544 5:116013908-116013930 ACATGTATGTAACAGCCAGGAGG + Intronic
996042936 5:118836774-118836796 CCATCTATGAACCAGTGAGTGGG + Intergenic
996194528 5:120587373-120587395 CCAGCTATGAAAGTCCTAGGTGG - Intronic
996258400 5:121434999-121435021 CCCTCTCTGATACAGCTAGAAGG + Intergenic
996516283 5:124373076-124373098 CCATCTATGAACCAGAAAGCAGG - Intergenic
997109359 5:131058141-131058163 CCATCTATTAAACAGGAAGTGGG - Intergenic
997385810 5:133471552-133471574 CCATCTATGAACCAGAAAGTGGG + Intronic
998806355 5:145920921-145920943 CCATCTATGAACCAGAGAGCAGG + Intergenic
1000183073 5:158831577-158831599 CCACCTAGGAATCATCTAGGTGG - Intronic
1000228261 5:159290732-159290754 CCATGTGTGAAATAGCTAGAAGG - Intergenic
1000259037 5:159568359-159568381 CCATCTATGAATCAGAAAGCAGG - Intergenic
1000786325 5:165548950-165548972 CCATCTATGAACCAGGAAGTAGG - Intergenic
1001659121 5:173377370-173377392 CCATCTATGAACCAGAAAGCAGG + Intergenic
1001744253 5:174078781-174078803 CCATCTATGAACCAGAAAGTGGG + Intronic
1001904610 5:175461403-175461425 CTATCTGTGAAAGAGCCAGGAGG + Intergenic
1003113233 6:3266016-3266038 ACACCTATGAAAAAGCAAGGCGG - Intronic
1003310984 6:4969828-4969850 CCATCTATGAAAGAGAAAGTCGG - Intergenic
1003636052 6:7832426-7832448 CCATCTATGAACCAGGGAAGAGG + Intronic
1005238069 6:23789325-23789347 CCATCTATGTTACAGCTACTTGG - Intergenic
1005535904 6:26755550-26755572 CCATCTGTAATACAGCAAGGGGG + Intergenic
1006949952 6:37813506-37813528 CCATCTATGAACCAGAAAGTGGG + Intergenic
1007178583 6:39912722-39912744 TCATCCATGAAACAGGGAGGTGG + Intronic
1008765604 6:54910152-54910174 CCATCTATGAAACAGCTAGGTGG - Intronic
1009759510 6:67985559-67985581 CCATCTATGAACCAGAAAGCAGG + Intergenic
1010049686 6:71488031-71488053 CCATCTATGAATCAGAAAGAGGG + Intergenic
1011441310 6:87390576-87390598 CCATCTATGAATCAGAAAGTGGG - Intronic
1012218874 6:96623706-96623728 CCATGTAAGAAGCAGCTAGATGG + Intergenic
1012853896 6:104478526-104478548 CCATCTCTGAAACAGACAGTGGG - Intergenic
1014612311 6:123560368-123560390 TCACCTATAAAACAGCTTGGTGG - Intronic
1015797258 6:137025357-137025379 CCATCTATGAACCAGGAAGTGGG + Intronic
1016062691 6:139646786-139646808 CCTTCTATGAAACAGGAAGAGGG + Intergenic
1016388034 6:143548138-143548160 CCATCTATGAACCAGGAAGCAGG - Intronic
1016540390 6:145157906-145157928 CCATCTATGAACCATGAAGGGGG + Intergenic
1016753444 6:147657692-147657714 CCGTCTATGAACCAGCAAGCAGG - Intronic
1017595655 6:156025940-156025962 CCATCTATGAACCAGAAAGCAGG + Intergenic
1017607672 6:156150842-156150864 TCATCTATGAAGCAGAAAGGGGG - Intergenic
1018484075 6:164222576-164222598 CCGTCTATGAAACAGGCAGTAGG + Intergenic
1021767319 7:23962994-23963016 CCATCTATGAACCAGAAAGCCGG + Intergenic
1023128863 7:36982810-36982832 CCATTTATAAAACAGATAGAAGG + Intronic
1024253476 7:47523127-47523149 CCATCTATGAACCAGGAAGTGGG - Intronic
1024267783 7:47619910-47619932 CCATCTATGAACCAGAAAGCAGG + Intergenic
1024425982 7:49226993-49227015 CCATCTATGAACCAGGAAGCAGG + Intergenic
1024814458 7:53252814-53252836 CCCTCTATGAAACAGAAAGGTGG + Intergenic
1025533351 7:61917754-61917776 CTATCTGTGAAACTGCTATGTGG + Intergenic
1025963820 7:66248982-66249004 CCATCTATGAACCAGACAGCAGG - Intronic
1026182508 7:68054312-68054334 CCATCTATGAAGCAGAGAGCAGG + Intergenic
1028184699 7:87768749-87768771 CCATGCAGGAAACAGCTGGGAGG - Intronic
1028224064 7:88229323-88229345 CCATCTATGAACCAGAAAGCGGG + Intergenic
1031237269 7:119192094-119192116 CCATCTATGAACCAGAAAGTAGG - Intergenic
1031308929 7:120169130-120169152 CCATCTATGAACCAAGAAGGCGG - Intergenic
1032609285 7:133393692-133393714 CCATCTATGAAACAGGACAGGGG + Intronic
1033602065 7:142895576-142895598 CCATCTAGGAAACAGCTTTCTGG + Intergenic
1033730684 7:144175965-144175987 CCATCTATGAACCAGAAAGTTGG + Intergenic
1034010275 7:147522048-147522070 CCATCTATGAACCAGAAAGTAGG - Intronic
1034056878 7:148044621-148044643 CCATCTATGAAGCAGAGAGTCGG + Intronic
1034247250 7:149656194-149656216 CCATCTATGAACCAGGAAGTGGG + Intergenic
1034743208 7:153497444-153497466 CCATCTATGAACCAGAAAGTGGG - Intergenic
1037567842 8:20132529-20132551 TCATCTATGAAACAGGGAGTTGG - Intergenic
1037928746 8:22865199-22865221 CCATTTCTGAAACAGCCTGGGGG + Intronic
1040123809 8:43712861-43712883 CTATCTGTGAAACAGCTTTGTGG + Intergenic
1040283539 8:46086790-46086812 CTATCTGTGAAACTGCTATGTGG + Intergenic
1041212329 8:55564782-55564804 CCATCTATGAACCAGGAAGTGGG + Intergenic
1041718274 8:60951650-60951672 CCATCTATGAACCAGGAAGCAGG - Intergenic
1041979814 8:63844683-63844705 CCATCTATGAACCAGGAAGCAGG + Intergenic
1043396321 8:79841519-79841541 CCATCTATGAACCAGAAAGAGGG + Intergenic
1044111082 8:88275143-88275165 CCATCTCTGAAAAAGCTATGAGG + Intronic
1044525662 8:93248030-93248052 CTATCACTGAAACAGCAAGGGGG - Intergenic
1044639611 8:94365021-94365043 CTATCTATGAAACAGAGAGCAGG + Intergenic
1044646781 8:94452053-94452075 CCATCTATGAACCAGAAAGGAGG - Intronic
1044725678 8:95192482-95192504 CCATCTATGAACCAGAAAGTGGG + Intergenic
1047063252 8:121251219-121251241 CCATCTATGAACCAGGAAGAAGG + Intergenic
1047617359 8:126573690-126573712 CCATCTATGAATCAGGAAGTGGG + Intergenic
1048588356 8:135797133-135797155 CCATCAATTAAGCATCTAGGAGG - Intergenic
1049934065 9:483796-483818 ACATCTCTGAAAGAGCTAGCAGG - Intronic
1050093653 9:2041389-2041411 CCATCTATGAATCAGGAAGCAGG - Intronic
1050127085 9:2368230-2368252 GGACCCATGAAACAGCTAGGTGG + Intergenic
1050640420 9:7661629-7661651 CCATCTATGAACCAGAAATGGGG - Intergenic
1050759671 9:9052119-9052141 CCATCTGTGAACCAGGAAGGCGG - Intronic
1051464757 9:17365186-17365208 CTATCAATGGAACAGCAAGGGGG - Intronic
1051551008 9:18329195-18329217 CCATCTATGAAGCAGGAAGTAGG + Intergenic
1051589848 9:18766659-18766681 CCATCTATGAACCAGAAAGAGGG - Intronic
1053578789 9:39381476-39381498 CCATCTATAAATCAGCTAATAGG + Intergenic
1054100372 9:60940280-60940302 CCATCTATAAATCAGCTAATAGG + Intergenic
1054121770 9:61215906-61215928 CCATCTATAAATCAGCTAATAGG + Intergenic
1054121815 9:61216331-61216353 CCATCTATGAACCAGAAAGCAGG - Intergenic
1054585973 9:66966605-66966627 CCATCTATAAATCAGCTAATAGG - Intergenic
1054704530 9:68449052-68449074 CCATCTATGAACCAGGAAGCAGG - Intronic
1055085870 9:72313919-72313941 CCATCTATGAGCCAGCAAGCAGG - Intergenic
1055618217 9:78095146-78095168 CCATCTATGAACCAGGAAGAGGG + Intergenic
1055633930 9:78255522-78255544 CCATCTATGAACCAGAAAGCAGG - Intronic
1055923853 9:81489807-81489829 CCATCTATGAACCAGAAAGTGGG - Intergenic
1056804053 9:89714201-89714223 CCATCTATGAACCAGGAAGCGGG - Intergenic
1056898674 9:90577933-90577955 CCATGTATGAAACAGAGGGGAGG - Intergenic
1058032230 9:100213006-100213028 CCATCTATGAACCAGGAAGCAGG - Intronic
1058035836 9:100251682-100251704 CAATTTAAGAAACAGCGAGGTGG - Intronic
1058166029 9:101620243-101620265 CCATCTATGAACCAGAAAGCAGG - Intronic
1058438615 9:104987374-104987396 CCATCTATGAATCAGAAAGTGGG - Intergenic
1058991747 9:110260357-110260379 CCATGTATGTCACAGCCAGGCGG + Intergenic
1059564698 9:115372098-115372120 CCATCTATGAACCAGGAAGCAGG - Intronic
1185671058 X:1810436-1810458 CCATCTATGAACCAGGAAGTGGG + Intergenic
1185872265 X:3673930-3673952 CCATCTATGAACCAGGAAGCGGG + Intronic
1185876766 X:3708221-3708243 CCATCTATGAACCAGGAAGCAGG + Intronic
1185885678 X:3780489-3780511 CCATCTATGAACCAGGAAGGAGG + Intergenic
1186057098 X:5661322-5661344 CCATCTATGTACCAGGAAGGGGG + Intergenic
1186174502 X:6910868-6910890 CCATCTATGAACCAGGGAGCAGG - Intergenic
1186450906 X:9672969-9672991 CCATCTATGAACCAGGAAGCGGG - Intronic
1187178183 X:16915819-16915841 TCATCTATGAATCAGGAAGGAGG + Intergenic
1189385953 X:40537033-40537055 CCATCTATGAACCAGGAAGTGGG + Intergenic
1189575986 X:42354155-42354177 CCATCTATGAACCAGGAAGCAGG - Intergenic
1189903257 X:45730485-45730507 ACTTCTATGAAACAACTTGGTGG - Intergenic
1190723375 X:53170317-53170339 CCATCTATGAACCAGAAAGTGGG - Intergenic
1193489828 X:82135163-82135185 CCATCAAAAAAACAGCAAGGGGG + Intergenic
1196005135 X:110828842-110828864 CCATCTATGAACCAGAGAGTGGG - Intergenic
1196470418 X:116017986-116018008 CCATCTATGAACCAGGAAGTGGG - Intergenic
1197733732 X:129834162-129834184 CCATCTATGAACCAGAAAGCAGG + Intronic
1198835326 X:140798744-140798766 CCATCTATGAACCAGAAAGTGGG - Intergenic
1199062360 X:143374102-143374124 TCATCTGTAAATCAGCTAGGTGG - Intergenic
1199123117 X:144081628-144081650 CCATCTATGAACCAGGAAGTGGG + Intergenic
1200788597 Y:7280189-7280211 CCATCTATGAACCAGGAAGCAGG - Intergenic
1200791639 Y:7304751-7304773 CCATCTATGAACCAGGAAGCGGG - Intergenic
1201254700 Y:12095861-12095883 CCATCTATGAACCAGGAAGTGGG - Intergenic
1201554131 Y:15250879-15250901 CCATCTATGAACCAGGAAGCGGG + Intergenic
1201676107 Y:16586143-16586165 CCATCTATGAACCAGGAAGTAGG + Intergenic