ID: 1008766232

View in Genome Browser
Species Human (GRCh38)
Location 6:54918858-54918880
Sequence CGGGGAGTTACACCATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 29}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008766232_1008766237 4 Left 1008766232 6:54918858-54918880 CCCTCAAATGGTGTAACTCCCCG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008766232 Original CRISPR CGGGGAGTTACACCATTTGA GGG (reversed) Intronic
908103627 1:60816861-60816883 GGGGCATTTAGACCATTTGATGG + Intergenic
921932907 1:220769708-220769730 CAGGGAGTTAAACAACTTGAGGG - Intronic
1064247541 10:13680969-13680991 CAAGGCGTTACACCATTTAATGG - Intronic
1070938625 10:80322455-80322477 TAGGGAGTTAGAGCATTTGAGGG + Intergenic
1083657281 11:64235570-64235592 AGGGGAGTTACACAAGATGATGG - Intronic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1106995722 13:35478045-35478067 CCGGGAGTTATAGGATTTGACGG - Intronic
1123724294 15:23086754-23086776 CTGGGAGTTACACACTTTTATGG + Intergenic
1137563948 16:49521840-49521862 CGGGGGGATTCACCATTAGATGG - Intronic
1150157566 17:62866895-62866917 CTCAGAGTTACACCATCTGAGGG - Intergenic
1161311695 19:3598078-3598100 CGGGGAGTTACAGCATGGGGTGG + Intronic
928321388 2:30285211-30285233 GGGATATTTACACCATTTGAAGG + Intronic
934122943 2:88857526-88857548 CTGGGAGTTACCCGATTGGAGGG + Intergenic
1170096971 20:12656661-12656683 CGGGGAGTTTCTCCATATCATGG + Intergenic
1174345812 20:49929038-49929060 CTGAGAGTTACAGGATTTGAGGG + Intergenic
1181582419 22:23835578-23835600 TGGGGAGTTCCACTCTTTGATGG - Intronic
955538131 3:59946463-59946485 CGGGAAGTTAAACCATCTGTTGG - Intronic
972195231 4:36646158-36646180 CGGGCGGTTACACCTTTAGAGGG - Intergenic
992322100 5:75623562-75623584 CGGTGAGTTAGTCCATTTGTAGG - Intronic
996431633 5:123385945-123385967 GTGGGAATTACAGCATTTGAAGG - Intronic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1009983861 6:70758950-70758972 CATGGAGTTACCCCATTTGGTGG + Intronic
1024489744 7:49966857-49966879 TGGGAATTTACACCATTAGATGG - Intronic
1026309436 7:69170964-69170986 CGGGGACTTGCAACATTGGAGGG - Intergenic
1036964512 8:13280975-13280997 TGTGGAGTTACAGCATTTTAGGG - Intronic
1042913098 8:73846759-73846781 TGGGGAGTTAAAGCATTTTAAGG + Intronic
1043933972 8:86121778-86121800 CAGGAAGTTACTTCATTTGATGG - Intronic
1051328730 9:16000888-16000910 CGCAGAGTTACAGCCTTTGATGG + Intronic
1060962879 9:127693559-127693581 CGGGGAGTGAGACCCTTTGTAGG + Intronic
1201401818 Y:13611668-13611690 CGGGCAGTTACACAGTTAGATGG - Intergenic