ID: 1008766237

View in Genome Browser
Species Human (GRCh38)
Location 6:54918885-54918907
Sequence GCTTCCTCTTTTGCTTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008766231_1008766237 5 Left 1008766231 6:54918857-54918879 CCCCTCAAATGGTGTAACTCCCC 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data
1008766233_1008766237 3 Left 1008766233 6:54918859-54918881 CCTCAAATGGTGTAACTCCCCGC 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data
1008766227_1008766237 27 Left 1008766227 6:54918835-54918857 CCTCCTCTCTGTCTTCCAGCATC 0: 1
1: 0
2: 3
3: 70
4: 672
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data
1008766228_1008766237 24 Left 1008766228 6:54918838-54918860 CCTCTCTGTCTTCCAGCATCCCC 0: 1
1: 0
2: 4
3: 62
4: 571
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data
1008766232_1008766237 4 Left 1008766232 6:54918858-54918880 CCCTCAAATGGTGTAACTCCCCG 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data
1008766230_1008766237 12 Left 1008766230 6:54918850-54918872 CCAGCATCCCCTCAAATGGTGTA 0: 1
1: 0
2: 1
3: 3
4: 95
Right 1008766237 6:54918885-54918907 GCTTCCTCTTTTGCTTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008766237 Original CRISPR GCTTCCTCTTTTGCTTTGTA AGG Intronic
No off target data available for this crispr