ID: 1008768322

View in Genome Browser
Species Human (GRCh38)
Location 6:54947083-54947105
Sequence GCAATAGGTCGAGTGTTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008768322_1008768324 11 Left 1008768322 6:54947083-54947105 CCTCAGAACACTCGACCTATTGC No data
Right 1008768324 6:54947117-54947139 GCCCTTGTGCTCTTGTTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008768322 Original CRISPR GCAATAGGTCGAGTGTTCTG AGG (reversed) Intergenic
No off target data available for this crispr