ID: 1008771223

View in Genome Browser
Species Human (GRCh38)
Location 6:54981034-54981056
Sequence TCCAAAATTAATATTCACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008771223_1008771224 25 Left 1008771223 6:54981034-54981056 CCATAGTGAATATTAATTTTGGA No data
Right 1008771224 6:54981082-54981104 TTCATAAGTACTGAATAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008771223 Original CRISPR TCCAAAATTAATATTCACTA TGG (reversed) Intergenic
No off target data available for this crispr