ID: 1008781097

View in Genome Browser
Species Human (GRCh38)
Location 6:55106353-55106375
Sequence TAGGTTGGCAGGGAAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008781097_1008781102 1 Left 1008781097 6:55106353-55106375 CCAGCAACTTCCCTGCCAACCTA 0: 1
1: 0
2: 1
3: 15
4: 197
Right 1008781102 6:55106377-55106399 CAGAGCACAGCAAGATCTCAAGG 0: 1
1: 0
2: 3
3: 23
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008781097 Original CRISPR TAGGTTGGCAGGGAAGTTGC TGG (reversed) Intergenic
900327640 1:2116944-2116966 TTTTTTGGCAGGGGAGTTGCGGG + Intronic
900389292 1:2427128-2427150 CAGGGTAGCAGGGAAGTAGCAGG + Intronic
901120630 1:6890272-6890294 TAGGTTGTGAGGGAATTTCCAGG + Intronic
901947006 1:12712228-12712250 TAGGTTGGGAGGGAACAGGCTGG + Intergenic
903416301 1:23185508-23185530 CCGGAGGGCAGGGAAGTTGCTGG + Intergenic
903684218 1:25119254-25119276 TAGGAGGGCTGGGAACTTGCTGG + Intergenic
904420431 1:30387443-30387465 GAGGTTGGCAGGGCAGTGGTAGG + Intergenic
908134422 1:61115538-61115560 AAGGTTGGCAAGGGACTTGCAGG + Intronic
909828354 1:80154232-80154254 CAGGTTGCCAGGGAAGTGACAGG + Intergenic
912377627 1:109224200-109224222 TAGGGAGGCAGGGAACTTGGAGG + Intronic
912734279 1:112136155-112136177 TATGTTGGCCAGGATGTTGCAGG - Intergenic
917312268 1:173690213-173690235 TAGGTTGGGAGGGAACAGGCTGG + Intergenic
918064641 1:181090871-181090893 TGGGTTGGGAGGGAAGTGGGAGG + Intergenic
919480264 1:198079540-198079562 AAGGTTGGCAGGGGTGCTGCTGG - Intergenic
923342882 1:233022471-233022493 GAGGTTGGAAGAGAAGCTGCGGG + Intronic
924270339 1:242325767-242325789 TGGGATGGCAGGGAAGGTGTAGG - Intronic
1063444243 10:6099141-6099163 TTGCTTTGCAGGGAAGATGCAGG + Intronic
1066714592 10:38273034-38273056 TGGGATGGCAGGGAAGGTGTAGG + Intergenic
1067143757 10:43678705-43678727 TTGGTGGGCAGGGAAGATGGTGG - Intergenic
1067432949 10:46255904-46255926 TAGGTTGGCCAGGCAGTTGCTGG - Intergenic
1070571297 10:77640849-77640871 GAGGTAGGCAGGGAAGTTTCTGG - Intergenic
1070812779 10:79306645-79306667 TAGGAGGGCAGGAAAGTTGCAGG - Intronic
1071544850 10:86521546-86521568 GAGGCGGGGAGGGAAGTTGCGGG - Exonic
1071986092 10:91052030-91052052 AGGCTTGGCAGGGAAATTGCTGG - Intergenic
1072165871 10:92812677-92812699 GAGGTGGGCAAGGAAGTTGAAGG - Intergenic
1072619330 10:97069127-97069149 TGGGCTGGCAGGGAAATTACTGG + Intronic
1073088313 10:100910468-100910490 TAGGATGGCAGGGGGGTTACTGG - Intergenic
1074915030 10:117947336-117947358 AAGGTTGGCTGGGCAGTTGGAGG - Intergenic
1078560106 11:12363924-12363946 TTGGTGGGCAGGGAAGTCACAGG - Intergenic
1080362260 11:31529545-31529567 GAGGTTAGCAGGGAATTGGCTGG - Intronic
1084850920 11:71939415-71939437 TAGGGGTGGAGGGAAGTTGCGGG - Intronic
1088570582 11:111219626-111219648 TAGGCTGGCAGGGAGGAAGCAGG + Intergenic
1089011755 11:115137300-115137322 CAGGTTGGCGGGGATGTTCCTGG - Intergenic
1090794921 11:130126702-130126724 TTGGTTGGCAGAGGAGTTGGAGG - Exonic
1091736397 12:2925495-2925517 TAGGGGAGCAGGGAAGTAGCTGG + Intronic
1092232266 12:6782843-6782865 GAGGTGGGCAGGGAAATTTCTGG - Intergenic
1092818477 12:12331504-12331526 AAGGTTGGCAGGGAGAATGCGGG + Intronic
1095968826 12:47887481-47887503 TATGTTGTGAGTGAAGTTGCAGG + Intronic
1097602650 12:61713550-61713572 GAGGTTGTCAGGGAGGGTGCTGG - Intronic
1100024592 12:90112390-90112412 CAAGTTGGCAGGGAAGTAGCTGG - Intergenic
1100906473 12:99305815-99305837 TTGTATGGCAGAGAAGTTGCTGG - Intronic
1103736577 12:123064580-123064602 CAGCCTGGCAGGGAAGTGGCGGG - Intronic
1108319667 13:49276533-49276555 GAGGTTAGCAGGGAAGATACTGG - Intronic
1110490363 13:76096539-76096561 TAAGTTGTCAGTAAAGTTGCAGG + Intergenic
1110660429 13:78054382-78054404 TAGTTTGGCAGGGAACCTGTGGG - Intergenic
1110885933 13:80635797-80635819 TAGCCTGGCAGTGATGTTGCTGG + Intergenic
1112044054 13:95577589-95577611 TAGGTAGGCAGGAATGTTGATGG + Intronic
1113524881 13:110966968-110966990 TAGGTTGGGAGGGAACAGGCTGG - Intergenic
1114982843 14:28187938-28187960 TAGGGTGGCAGGGAGGGTGAGGG + Intergenic
1116859140 14:49979651-49979673 TTGGTTGGTAGTGAAGTTGGAGG + Intergenic
1118121599 14:62850751-62850773 CAGAGGGGCAGGGAAGTTGCGGG - Intronic
1119407373 14:74407179-74407201 GAGGTTGGCAGGGTAGGTGGTGG + Exonic
1119600176 14:75970630-75970652 GAGGTGGTCAGGGAGGTTGCTGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1119852109 14:77873570-77873592 TAGGTTGGCTGGGATGAGGCTGG + Intronic
1120440122 14:84525905-84525927 TAGGTAGACAGGAAAGTTGTAGG + Intergenic
1122037006 14:98956283-98956305 CAGGCTGGCAGGGCAGGTGCTGG + Intergenic
1128614606 15:69099401-69099423 TATGTTGGCAGGGAGGGTCCAGG + Intergenic
1128775059 15:70313929-70313951 AGGGTTGGCAGGGAAGGTGTAGG - Intergenic
1131040167 15:89257229-89257251 TAGTTTGGAAGGGAAGTAGGGGG - Intronic
1131373289 15:91902537-91902559 TAGGTTGGCAGAACAGTGGCAGG - Intronic
1133024313 16:2981010-2981032 CCTGTTGGCAGGGAAGCTGCAGG - Intergenic
1133797936 16:9061724-9061746 TGGGTTGCCAGGGAAGCTGTTGG - Intergenic
1136350590 16:29704580-29704602 TAGGTTGGAATGGAAAGTGCAGG - Intergenic
1136548107 16:30966525-30966547 TGGGTGGGCAGGGGAGTTGAGGG + Intronic
1140816906 16:78629570-78629592 GAGGTTGGCAGGGGTCTTGCAGG - Intronic
1142564740 17:832721-832743 TAGGGAGGGAGGGAAGATGCAGG - Intronic
1145006502 17:19341584-19341606 TAAGCTGGCAGGGAGGGTGCTGG + Intronic
1145850743 17:28093164-28093186 TTAGTTGGGAGGGGAGTTGCAGG + Intronic
1147164144 17:38584505-38584527 TGGGGTGGCCGGGAAGTGGCGGG + Intronic
1147307025 17:39571072-39571094 TGGGATGGCAGGTATGTTGCGGG - Intergenic
1147542171 17:41369628-41369650 CACATTGGCAGGGATGTTGCAGG + Exonic
1147910364 17:43852657-43852679 AAGGGTGGCAGGGAAGAAGCAGG + Intronic
1149678621 17:58488221-58488243 CAGCTTGGCGGGGAAGTTGTTGG + Exonic
1151280286 17:73068921-73068943 TAGGTTGATGGGGAAGTTTCTGG - Intronic
1151467669 17:74298035-74298057 TAGTTTGGCAGGGACGTTTATGG - Intronic
1152367456 17:79864837-79864859 CAGGCTAGCAGGGAAGGTGCAGG - Intergenic
1155740953 18:29286959-29286981 TAGGTAGGCATGGAAGATTCAGG + Intergenic
1155756553 18:29504981-29505003 GGGGTTGTCAGGGACGTTGCAGG + Intergenic
1156445841 18:37236227-37236249 TAGGTAGGCTGGGAATATGCTGG - Intergenic
1157703317 18:49779341-49779363 CAGGTTGTCAGGGAAGTGGTGGG + Intergenic
1161239080 19:3211732-3211754 TATGTTAGCAGGGAAGATGATGG - Intergenic
1162032105 19:7921950-7921972 TAGGGTGGCAGGGAGGATGGGGG + Intronic
1163695143 19:18760175-18760197 CAGGTTGGCCGCGAGGTTGCCGG - Exonic
1164746641 19:30621148-30621170 TTGCTTGGCAGGGAAGGGGCAGG + Intronic
1166331443 19:42080198-42080220 CAGGTTGGCAGGTGAGTTGAAGG - Exonic
1167464706 19:49644706-49644728 TAGGTTGTTGGGGAAGCTGCGGG + Intronic
925615794 2:5743545-5743567 TAGGGTGGCAGGGCAGGGGCTGG - Intergenic
925760554 2:7180397-7180419 TTGGTTGGCAGAGAATTTGGGGG - Intergenic
928445560 2:31330919-31330941 TTGGATGGAAGGGAAGATGCAGG - Intergenic
928454628 2:31408153-31408175 CAGCTTGGCAGGGAAGTAGAAGG - Intronic
928590825 2:32813304-32813326 TAGTTAGGCAGGGAAGTAGAAGG - Intronic
931252462 2:60545467-60545489 TGGGCTGGCAGGGTAGTTGGAGG - Intronic
932384918 2:71323437-71323459 CAGGTTGTCAGGGAAGTCGGGGG + Intronic
932688796 2:73895056-73895078 TAGGTTGGGAGGGAAGAGGGCGG + Intronic
935802105 2:106708059-106708081 TAGGTTGGACAGGAAGCTGCTGG + Intergenic
937275229 2:120679748-120679770 TAGGGTGGCTGAGAAGCTGCAGG + Intergenic
941163792 2:162063806-162063828 TAGGTTGGCAGGGATGAGGGTGG + Intronic
945142123 2:206698279-206698301 TGGGTTTGCAGAGAATTTGCAGG - Intronic
945482597 2:210360930-210360952 CAGGTTGTCAGGGAAGGTGGGGG + Intergenic
945656535 2:212631357-212631379 AAGGTTGTTAGGGAAGTTGAAGG - Intergenic
948602775 2:239116734-239116756 CAGGGTGGCAGGGAGGCTGCAGG - Intronic
1168924539 20:1568341-1568363 TAGGCTGGCAGGCAAACTGCAGG - Intronic
1169126130 20:3128231-3128253 TAGTTGGGCAGGGAAGCTGGGGG - Intronic
1169710191 20:8552402-8552424 TAGATTTGCAGGGAAGTGGATGG + Intronic
1169974131 20:11304370-11304392 TAGCCTGGCAGTGAAGTTGTGGG - Intergenic
1170245786 20:14220291-14220313 CAGGTTGTCAGGGAAGTTGGGGG + Intronic
1170392836 20:15894033-15894055 TAGTTTGGCAAGAAAGTGGCCGG + Intronic
1170398830 20:15958284-15958306 TAGGATGGCAGGGAGGTGGTGGG - Intronic
1171198914 20:23225457-23225479 TAGGCTGGCACGGAGGTTGGGGG - Intergenic
1172749348 20:37239065-37239087 TAGGATGGGAGGGAAGTGGAGGG + Intronic
1175370228 20:58483325-58483347 GAGGTGGGCAGGGAGCTTGCAGG + Intronic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1178278161 21:31257855-31257877 GAGGTTGGCATGGTAGTTGGAGG - Intronic
1180230508 21:46424263-46424285 TAAGTGGGCAGGGTAGGTGCTGG + Intronic
1182099182 22:27645893-27645915 TTACTTGGCAGGGAAATTGCCGG - Intergenic
1182413822 22:30208354-30208376 TAAGTGGGCAAGGAAGTTTCTGG - Intergenic
1183360414 22:37380266-37380288 GAGGTCAGCAGGGAAGATGCAGG + Intronic
1184751384 22:46488373-46488395 TAGGCGAGCAGGGAAGCTGCGGG - Intronic
950603570 3:14057882-14057904 TAGGTTGTCAGGGAAGTTGGGGG + Intronic
950934876 3:16828705-16828727 TTGGTTGGCAGGAAAGATGGTGG + Intronic
952257417 3:31707359-31707381 TAGGTTTTCAGGAAAGTTGCAGG - Intronic
953185279 3:40631701-40631723 CAGGTTGCCAGGGAAGTGGGGGG - Intergenic
955744845 3:62130085-62130107 TAGGTTGGCTGGTCAGTTGTGGG + Intronic
957540400 3:81561954-81561976 TATTTAGGCAAGGAAGTTGCAGG - Intronic
958013780 3:87914574-87914596 CAGGTTGTCAGGGAAGTGGGGGG - Intergenic
959452412 3:106519932-106519954 TTGGTTGGCAAGGAACCTGCTGG + Intergenic
960185255 3:114630334-114630356 TTGGATGGCAGAGAAGTTGCTGG + Intronic
960929239 3:122827829-122827851 TGGGTTTGTAGGGAAGTTGAGGG + Intronic
961130935 3:124467096-124467118 CAGGTTGGGAGGGCAGTGGCTGG - Intronic
961582232 3:127892270-127892292 TAGGTTGGGAGGGAACAGGCTGG - Intergenic
962247075 3:133804544-133804566 TAGGTTGGACAGGGAGTTGCTGG + Intronic
962684478 3:137833791-137833813 TAGGTTGTCAGGGAATTTCTAGG - Intergenic
964158954 3:153622560-153622582 TACATAGGCAGGGAAGTTGATGG - Intergenic
964541679 3:157786614-157786636 TAGGTTGGTAGGGAGTTTGCAGG - Intergenic
969277855 4:6149002-6149024 TAGGTTTGCAGGGGGGTGGCGGG + Intronic
969670991 4:8590275-8590297 GAGGCTGGCAGGGAGCTTGCAGG + Intronic
976139520 4:81976392-81976414 TAGGTGAGCAGGGGGGTTGCAGG + Intronic
976562176 4:86514295-86514317 GAGGTTGGAAGGGCAGTTGCTGG - Intronic
976856462 4:89610154-89610176 CAGGTTGTCAGGGAAGTTGGGGG - Intergenic
977764388 4:100779444-100779466 AAGGTTGGACAGGAAGTTGCTGG - Intronic
980523512 4:133960793-133960815 CAGGTTGTCAGGGAAGTGGGAGG - Intergenic
983807979 4:172018470-172018492 TAGTTTGCCAGGGAAGTTGGGGG + Intronic
984475000 4:180224801-180224823 CAGGTTGTCAGGGAAGTGGAGGG + Intergenic
984689996 4:182715722-182715744 TGGGTTGGAAGGGAGGTTGAGGG - Intronic
989126288 5:38055254-38055276 GGTGTTGTCAGGGAAGTTGCTGG + Intergenic
992360287 5:76031171-76031193 CAGTTTGGTAGGGAAGTTGTGGG - Intergenic
992874285 5:81037396-81037418 TAGGATAGCATTGAAGTTGCCGG - Intronic
996075786 5:119192092-119192114 TAGGATGGAAGGGGAGATGCAGG - Intronic
997528962 5:134570602-134570624 GAGGTGGGCAGGGAGGCTGCAGG - Intronic
998883392 5:146668428-146668450 AAGATTGGCAGGGAAGTGGGGGG - Intronic
999389487 5:151179906-151179928 TAGGGTGGGAGGGAACTTTCTGG - Intergenic
999408171 5:151325399-151325421 CAGGATGGCTGGGAAGTGGCGGG + Exonic
1000247695 5:159462550-159462572 TAGGTTTGCTGGGAGGTTCCAGG + Intergenic
1003450861 6:6230322-6230344 CAGGTTGTCAGGGAAGTTGGGGG - Intronic
1003823563 6:9927404-9927426 TAGATTAGCAGAGAAGATGCAGG - Intronic
1005275825 6:24216342-24216364 TAGGCTGTCAAGGAAGATGCGGG + Intronic
1006060323 6:31414230-31414252 TAGGTTGCAAGGGCAGTGGCCGG + Intronic
1006133863 6:31884060-31884082 AAGGTTGCCAGGTAAGATGCAGG + Intronic
1008781097 6:55106353-55106375 TAGGTTGGCAGGGAAGTTGCTGG - Intergenic
1010980371 6:82364182-82364204 TAGGATGCGAGGGAAGTTTCAGG - Intronic
1012444743 6:99296436-99296458 GAGGCTGGCAGGGGAGTTACAGG - Intronic
1013950578 6:115776290-115776312 TAAGTTGCAAGGGAAGTTGTTGG + Intergenic
1015767248 6:136731646-136731668 TAGGGTGGCAGGGGAGGTGAGGG + Intronic
1017326430 6:153146087-153146109 CAGGTTGCCAGGGAAGTGGGGGG + Intergenic
1019525839 7:1480061-1480083 AAGGATGGCAGGGAGGATGCAGG + Intronic
1019993135 7:4706416-4706438 GAGGTGGTCAGGGAAGTTCCAGG + Intronic
1021336180 7:19405341-19405363 CAAGTTGGCAGGAAGGTTGCTGG - Intergenic
1022041868 7:26588779-26588801 AAGGTTTGCAGAGAAGTAGCAGG + Intergenic
1022104100 7:27186024-27186046 GAGGTAGGCAGGGAAGATGAGGG - Intergenic
1022134168 7:27431830-27431852 GAGGTTGGCAGGGCAGTCCCTGG - Intergenic
1022565264 7:31393387-31393409 GAGGTTGGAAAGGCAGTTGCTGG - Intergenic
1023798297 7:43811795-43811817 TAGGTTGGGAGGGAACAGGCGGG - Intergenic
1024095020 7:45976368-45976390 GAGGATGGCAGGGGAGGTGCTGG - Intergenic
1026010090 7:66629348-66629370 CAGGTGGGCGGGGGAGTTGCAGG - Intronic
1026129092 7:67605748-67605770 GAGGCTGGCAGGGAAGTGGGTGG + Intergenic
1027225085 7:76238611-76238633 CAGGGTGGCAGGGAGGATGCTGG - Intronic
1027389167 7:77688481-77688503 GAGGTTTTCAGGGAAGTTCCTGG - Intergenic
1027683167 7:81245846-81245868 TAGGTGGGAAGGGAAGTGGGAGG + Intergenic
1032079399 7:128851136-128851158 GGGGTTGGCAGGGAGGCTGCTGG + Intronic
1033603788 7:142910048-142910070 CAAGTTGGCAGGGAAATTTCTGG + Intronic
1034238633 7:149592414-149592436 TAGGCTGGGTGGGAAGTTGTGGG - Intergenic
1034555090 7:151845379-151845401 TAGGTTGACAAGGACGCTGCTGG - Intronic
1037809885 8:22080972-22080994 AGGGATGGCAGGGAAGTTGGGGG + Intronic
1039880842 8:41624583-41624605 TAGGCTGGAAGGGCAGCTGCAGG + Exonic
1039993537 8:42511040-42511062 CAGGTAGACAGGGAACTTGCAGG + Intronic
1040849536 8:51884812-51884834 TTGGATGGCAGAGAAGTTGATGG - Intronic
1041053494 8:53959754-53959776 TAGGTTGCACGGGAAGTTGAGGG - Intergenic
1042088231 8:65131742-65131764 TAGGTTGGGAGGGAACAGGCTGG + Intergenic
1043909126 8:85840064-85840086 GAGGTTGGCAAGGAAATGGCAGG - Intergenic
1045634444 8:104167315-104167337 TATGTTGGCATGGATGTGGCTGG - Intronic
1047409965 8:124616265-124616287 TGGATTTGCAGGGAAGCTGCTGG + Intronic
1048395163 8:134007460-134007482 GAGGTTGGCAGGAAAGAAGCAGG + Intergenic
1049304550 8:141894045-141894067 TGGGTTTGCAGGGAAGGTGTTGG - Intergenic
1049801847 8:144521522-144521544 TAGGTAGGCAGGGCCTTTGCTGG + Exonic
1050133935 9:2441830-2441852 TAGTTTGCCAGGGAAGTAGAGGG + Intergenic
1050670609 9:7992457-7992479 TCCTTTGGCAGGGAAGTTGCTGG - Intergenic
1051104300 9:13561104-13561126 TTGGTGGGCAGGGAAGATGTGGG - Intergenic
1051279821 9:15431161-15431183 GGGGTTGGCAGGAAAGCTGCTGG - Intronic
1052993523 9:34536896-34536918 TAGGTGGGCAGGGAAGCGACAGG - Intergenic
1056414871 9:86366412-86366434 TAGGTTGGGAGGGAACAGGCTGG + Intergenic
1056461921 9:86816895-86816917 TAGATTGCCAGGGAAGAAGCTGG + Intergenic
1057196764 9:93119857-93119879 TTGGTGGGCAGGGAGGTTGGGGG + Intergenic
1059880172 9:118679395-118679417 CAGATTGGCAGGGAAGTTTAAGG + Intergenic
1060067863 9:120519610-120519632 TAGGTTGGATGGGCAGTTGCTGG - Intronic
1062039244 9:134396538-134396560 TAGGGTTGCAGGGACGTTGCAGG + Intronic
1062533486 9:137011654-137011676 GAGGACGGCAGGGAAGTTGGTGG + Exonic
1187670356 X:21659944-21659966 TGGGTTGGGAGGGCAGGTGCTGG + Intergenic
1188718983 X:33500018-33500040 CAGGTTGTCAGGGAAGTTTGGGG - Intergenic
1189834325 X:45005158-45005180 TAGGTTGGGAGGGAATGGGCTGG + Intronic
1197763404 X:130043455-130043477 TAGGTTGGTAGGGTGGCTGCAGG + Intronic
1197863121 X:130991291-130991313 GAGCTTGGCAGGCAAGTAGCTGG + Intergenic
1202299874 Y:23401079-23401101 TTGCTTGACAGAGAAGTTGCAGG - Intergenic
1202570936 Y:26269519-26269541 TTGCTTGACAGAGAAGTTGCAGG + Intergenic