ID: 1008786628

View in Genome Browser
Species Human (GRCh38)
Location 6:55175686-55175708
Sequence TCCCCCTAAACAATTTCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008786619_1008786628 -4 Left 1008786619 6:55175667-55175689 CCTCGACCCCTCATCCCCCTCCC 0: 1
1: 0
2: 9
3: 134
4: 1381
Right 1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1008786615_1008786628 28 Left 1008786615 6:55175635-55175657 CCCGGTCTAGGTCTGTATGCAAA 0: 1
1: 0
2: 0
3: 12
4: 98
Right 1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1008786620_1008786628 -10 Left 1008786620 6:55175673-55175695 CCCCTCATCCCCCTCCCCCTAAA 0: 1
1: 1
2: 5
3: 81
4: 748
Right 1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 140
1008786616_1008786628 27 Left 1008786616 6:55175636-55175658 CCGGTCTAGGTCTGTATGCAAAC 0: 1
1: 0
2: 1
3: 6
4: 71
Right 1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG 0: 1
1: 0
2: 0
3: 7
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008786628 Original CRISPR TCCCCCTAAACAATTTCTGA GGG Intronic
901867676 1:12117806-12117828 ACCCCTTAAATAATTTCTCATGG + Intronic
902938933 1:19785776-19785798 TCCCCCTGACCACTTCCTGAAGG - Intronic
905810718 1:40911129-40911151 TCCCCCAAAACACTGTCTCAAGG + Intergenic
905966481 1:42102537-42102559 TCCTGCTAAACCATTTTTGAAGG - Intergenic
906472133 1:46139979-46140001 TCCCTCAAAAAAATTTCAGATGG - Intronic
907679148 1:56547496-56547518 TCCCTGTAAACAATTCCTGATGG - Intronic
911537807 1:99121446-99121468 TCCCCCTAAATAATTGCTAATGG - Intergenic
912112009 1:106355004-106355026 TCCCACTGAACATTTGCTGAAGG + Intergenic
916284562 1:163091854-163091876 TTCCCCTAAACAAAATCTAAGGG - Intergenic
917265102 1:173212386-173212408 TCTCCCTAAACAACCACTGAAGG + Intergenic
919046464 1:192458793-192458815 TCCCCCAAGACAATTTCAGGGGG + Intergenic
919667004 1:200301997-200302019 TCCCCCAAAATACTTTCTCAAGG + Intergenic
920277852 1:204821085-204821107 ACCCCCAACACAATTTCTGCTGG - Intergenic
920732478 1:208500767-208500789 TTCCCCTCAACAATATCTTATGG - Intergenic
922064080 1:222119203-222119225 TTCCCATCAACAATGTCTGAGGG + Intergenic
1064021655 10:11813978-11814000 TCCCACTTAACATTTTATGACGG + Intergenic
1065323411 10:24529753-24529775 TCCCCGTGGAGAATTTCTGATGG + Intronic
1067159593 10:43813036-43813058 TCCCACTCAACAATATCAGAAGG - Intergenic
1067774295 10:49151012-49151034 TCACCCCAAACATGTTCTGATGG - Intergenic
1070382455 10:75893215-75893237 ACCCCCTAAAGAGTTACTGAGGG + Intronic
1070457096 10:76627997-76628019 TCCCCCTAAATTTTCTCTGAGGG + Intergenic
1070508809 10:77140856-77140878 TCCCCCTAAACCATGTCCAAAGG - Intronic
1070576739 10:77684943-77684965 TTCCCACAAACAATGTCTGAGGG - Intergenic
1071842959 10:89491823-89491845 TCCCACTGAACAATTTTTAAAGG + Intronic
1075149236 10:119911896-119911918 TCCCCCAAAACAAACTTTGAAGG - Intronic
1075346073 10:121682733-121682755 TCCCGCTCCACAATTTCTCAGGG + Intergenic
1075877093 10:125816570-125816592 TCTTCCTAAGCAATTTCCGATGG + Intronic
1079720782 11:23810925-23810947 TTGCACTAAACAATTACTGAGGG - Intergenic
1085437955 11:76526597-76526619 TGCCCATAAACAATTTTTGTTGG - Exonic
1089047387 11:115514617-115514639 TCCCCTTAAACAATTCCTTATGG + Intergenic
1089598915 11:119601104-119601126 TCAGCCTAAACCATTCCTGATGG - Intergenic
1092145826 12:6213992-6214014 TCCCCCAAGAAAATTTCTCAGGG + Intronic
1096553530 12:52389731-52389753 ACCCCCTAAAAAATGACTGAGGG - Intergenic
1096883557 12:54693801-54693823 TCCCCCTATACAAATGCTGAAGG + Intergenic
1097297350 12:57981014-57981036 TCCCTATAAACCATTTTTGAGGG + Intergenic
1098056937 12:66517152-66517174 TCCCCTTCAACAATCTCTAATGG + Intronic
1098187336 12:67911530-67911552 TGGCCCTAAACATTTTCTAAAGG - Intergenic
1099815640 12:87643822-87643844 CCCTCCTGTACAATTTCTGAAGG + Intergenic
1100012860 12:89974493-89974515 TGCCCCTAAAGACTTTCTGGTGG - Intergenic
1105245902 13:18650146-18650168 TCCCCCTATACATTCCCTGAGGG + Intergenic
1105253347 13:18721079-18721101 TCTTCTTAACCAATTTCTGAAGG - Intergenic
1106804543 13:33292676-33292698 TTTCCCTAAATAATTTGTGAAGG - Intronic
1106804546 13:33292734-33292756 TTTCCCTAAATAATTTGTGAAGG - Intronic
1113385205 13:109842302-109842324 TCCCCCTGCACCATGTCTGATGG + Intergenic
1119346138 14:73926275-73926297 TCCCCCTCAAAAATATCTTATGG + Intronic
1122401218 14:101468731-101468753 ACCCCCTAAAAAAGTGCTGATGG + Intergenic
1127796560 15:62443363-62443385 TCACCATTAACAATTTCTGTTGG + Intronic
1137229468 16:46550082-46550104 TCTCACAACACAATTTCTGAAGG - Intergenic
1143050813 17:4124331-4124353 CCCCACTAAATAATTTCAGAAGG + Intronic
1148582717 17:48754671-48754693 TCCCCCAAACCACTTTATGAGGG - Intergenic
1151852905 17:76701509-76701531 TCCCCCTGATCAATAGCTGATGG - Intronic
1154443015 18:14409518-14409540 TCCCCCTATACATTCCCTGAGGG - Intergenic
1156173784 18:34518040-34518062 TTCCCATAAACAATGTGTGAGGG + Intronic
1156408513 18:36805866-36805888 TCTGCATAAACATTTTCTGAAGG + Intronic
1159227912 18:65564586-65564608 TGCCCCAGAACAATTTCTGAAGG - Intergenic
1166504976 19:43365364-43365386 ACCCCCTGAACAAGCTCTGAGGG + Intergenic
1166505563 19:43369550-43369572 ACCCCCTGAACAAGCTCTGAGGG - Intergenic
1167092964 19:47357405-47357427 TCCAGCTAGATAATTTCTGAAGG - Intronic
1167441546 19:49512297-49512319 TCCCCTTAAAAAATTCCTGCAGG - Exonic
927954334 2:27198148-27198170 TCCCCAAAAACAATCTATGAAGG + Intergenic
928788813 2:34925544-34925566 TCTACCTAAACAATTCCTCATGG - Intergenic
934487685 2:94732174-94732196 TCTTCTTAACCAATTTCTGAAGG - Intergenic
935466756 2:103407207-103407229 TCTCCCCTAGCAATTTCTGAAGG - Intergenic
936853009 2:116924195-116924217 TCTCCCTAATCAATTATTGATGG - Intergenic
944454295 2:199877423-199877445 AAACACTAAACAATTTCTGAAGG + Intergenic
945731555 2:213543198-213543220 TCAACCTAACCAATTTCTTAGGG - Intronic
946605198 2:221396727-221396749 TCCCTGCAAAGAATTTCTGAGGG + Intergenic
1168989480 20:2081959-2081981 TCCTCCTAAACAATTTATTGAGG + Intergenic
1169398389 20:5257169-5257191 TCCACCTAAGCATTTTTTGAGGG - Intergenic
1169722432 20:8693190-8693212 TTCCCCAAAACATTTTCTGTGGG - Intronic
1170631407 20:18069622-18069644 TTCCCACCAACAATTTCTGAGGG + Intergenic
1170966032 20:21072365-21072387 TCCCCCTTAACAATGCCAGATGG - Intergenic
1170998760 20:21392371-21392393 GTCACCTAAACAATTACTGAAGG + Intergenic
1171125813 20:22601126-22601148 TTCCCTTAAACAATTTATTACGG + Intergenic
1176838854 21:13821010-13821032 TCTTCTTAACCAATTTCTGAAGG - Intergenic
1177631151 21:23729760-23729782 TCCCCCCAAAAAATTTATGTAGG + Intergenic
1179965631 21:44802990-44803012 TCCCCGGAAACACTTTCTGGCGG + Intergenic
1181799164 22:25333082-25333104 GCCCCCCAACCAATTTCTGCTGG - Intergenic
1182345488 22:29660972-29660994 TCCCCCAGAACAATCACTGAGGG - Intronic
949864024 3:8532586-8532608 TCCCGGTAAACAGTTTGTGATGG + Intronic
950943262 3:16916459-16916481 TCTCCTTAAATTATTTCTGATGG + Intronic
951634546 3:24758513-24758535 TGCACCTAAATAATTTTTGAAGG + Intergenic
953709611 3:45259227-45259249 TCCCCCAAGACAATCTCTAATGG + Intergenic
958476999 3:94597192-94597214 TCACTATAAACAATTTCTAAAGG + Intergenic
959051835 3:101531721-101531743 TCCTTGTAAACAATTTGTGAGGG - Intergenic
959597608 3:108145069-108145091 TCCTCCCAAAGACTTTCTGAAGG + Intergenic
960026000 3:113010423-113010445 TCCTACTAAAATATTTCTGAAGG + Intronic
961372437 3:126439868-126439890 CCCCCATAAACAATTCCTGCTGG - Intronic
962488038 3:135863859-135863881 TCCCCCAAAAAAATTTATGGAGG + Intergenic
964600417 3:158494817-158494839 TGCCCCTAAACACCTTCTGGTGG - Intronic
965906011 3:173707665-173707687 TTTCACTAAATAATTTCTGATGG - Intronic
969266303 4:6066327-6066349 TCACCTTACACAGTTTCTGAAGG + Intronic
974901082 4:67998938-67998960 TCCACCAAAAGAATTGCTGATGG - Intergenic
979164454 4:117509668-117509690 TGCTCCGAAACAATTCCTGAAGG - Intergenic
980272385 4:130602217-130602239 TCTCCCTAACCACATTCTGAAGG + Intergenic
981147657 4:141343816-141343838 TCCCCCAAAACAAATTGTAATGG - Intergenic
981449609 4:144881117-144881139 TCCTCTTAAACATTTTCTGGAGG - Intergenic
986438292 5:7756841-7756863 TCCCTCCAAACAATTTTTAACGG - Intronic
987428421 5:17800470-17800492 TACCCCTAAATAACTTCAGATGG - Intergenic
987733638 5:21809342-21809364 TTCCCCTAAAAAATTACAGAGGG + Intronic
988753614 5:34220272-34220294 TCCACATAAATAATTTCAGAAGG + Intergenic
990687581 5:58323508-58323530 TACCTCTAAATATTTTCTGATGG - Intergenic
990919036 5:60942673-60942695 TAACCCTAAAAAATTTTTGACGG - Intronic
992027354 5:72683487-72683509 TCCCAGTAAAGAATTTCTAAAGG + Intergenic
992374953 5:76179714-76179736 TGCCCCTAATCCATTGCTGATGG - Intronic
997036010 5:130192554-130192576 GCCCCCTAAAGAATCTCTGAAGG - Intergenic
1000061664 5:157662891-157662913 TCTTCCTAAACATATTCTGAAGG - Intronic
1004069038 6:12279874-12279896 TCCCTTTCAACAATCTCTGAAGG - Intergenic
1004270380 6:14189989-14190011 TTCCCCTAAATGGTTTCTGAGGG - Intergenic
1004533838 6:16480256-16480278 TCAAACCAAACAATTTCTGATGG + Intronic
1008786628 6:55175686-55175708 TCCCCCTAAACAATTTCTGAGGG + Intronic
1013491550 6:110651306-110651328 TCCTCCTGCCCAATTTCTGATGG + Intronic
1013980013 6:116119551-116119573 ATCCCCTAAAATATTTCTGATGG - Exonic
1023007710 7:35890404-35890426 TCCCCAAAAACAGTTACTGAAGG - Intronic
1025084311 7:56010071-56010093 TCCTCCAAATCAGTTTCTGAAGG - Intergenic
1029149986 7:98473100-98473122 TCTCCCAAAAGGATTTCTGAAGG - Intergenic
1032751428 7:134845769-134845791 TTTCCATACACAATTTCTGATGG - Intronic
1033420685 7:141202314-141202336 TGCCCCTAAACACCTTCTGCTGG - Intronic
1035110112 7:156474720-156474742 TTTCCCTAAACACTTTCTGCAGG + Intergenic
1038259471 8:25980522-25980544 TCCCCCTTATGAATTTTTGATGG - Intronic
1040133514 8:43825684-43825706 TCCCTCTAAAGAATCTGTGAAGG + Intergenic
1041150440 8:54926623-54926645 TGCCCCAAAACAAATTCAGAAGG + Intergenic
1041210655 8:55547608-55547630 TCCCCCAAAACAATTGCTTTGGG + Intergenic
1043195072 8:77281680-77281702 TACTCCTAAACAATTATTGAAGG + Intergenic
1044429916 8:92096235-92096257 TCCCCCAACACAATTTCTGGAGG - Intronic
1044943385 8:97366302-97366324 TGCCCCTGAACAAGATCTGATGG + Intergenic
1046584339 8:116133070-116133092 TTGCCCTATGCAATTTCTGAGGG - Intergenic
1046669387 8:117041381-117041403 TTGCCCTGAAAAATTTCTGATGG + Intronic
1046723116 8:117643918-117643940 TCCCCCCGAACAATGTATGAGGG - Intergenic
1046976400 8:120283071-120283093 TCAGCCAAGACAATTTCTGAAGG + Intronic
1047090483 8:121568983-121569005 TCCCTCTAAAAACTTTCTGGTGG + Intergenic
1050230684 9:3522860-3522882 TTACCCTAAACAATTTATTATGG - Intronic
1050481485 9:6092061-6092083 ACCACCTAGACAATCTCTGATGG - Intergenic
1051525832 9:18043351-18043373 TCCCCCCAAAAAATTTTTTAAGG - Intergenic
1053670115 9:40352237-40352259 TCTTCTTAACCAATTTCTGAAGG + Intergenic
1053919906 9:42978494-42978516 TCTTCTTAACCAATTTCTGAAGG + Intergenic
1054381238 9:64492225-64492247 TCTTCTTAACCAATTTCTGAAGG + Intergenic
1054514498 9:66024060-66024082 TCTTCTTAACCAATTTCTGAAGG - Intergenic
1060120738 9:120987219-120987241 GCCCCCTAATCAATGTCTCAAGG - Intronic
1061634765 9:131900533-131900555 TCCCCCTACACGAGTTCTGGGGG - Intronic
1061753873 9:132799225-132799247 TCTCCCTCAACAATAACTGATGG - Intronic
1185553591 X:1002989-1003011 CCCCCCAAACCCATTTCTGAAGG + Intergenic
1185972786 X:4683044-4683066 TCCACCAAAGAAATTTCTGAAGG + Intergenic
1186766935 X:12780531-12780553 TCACTCTAAAAAGTTTCTGAGGG + Intergenic
1198199141 X:134397930-134397952 TCCCCCCAAACATTTGCTCATGG - Intronic
1198380560 X:136079296-136079318 TCCTTCAAAACAATTTGTGAGGG - Intergenic
1199557942 X:149129453-149129475 TTTCTCTCAACAATTTCTGAGGG + Intergenic
1200739100 Y:6833768-6833790 TCTCCATAAACATTTGCTGAAGG - Intergenic