ID: 1008795167

View in Genome Browser
Species Human (GRCh38)
Location 6:55294169-55294191
Sequence CTGTATGCAAAGATGGGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008795167_1008795171 16 Left 1008795167 6:55294169-55294191 CCGAGTCCCATCTTTGCATACAG No data
Right 1008795171 6:55294208-55294230 TTGTATGTGCTAATTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008795167 Original CRISPR CTGTATGCAAAGATGGGACT CGG (reversed) Intergenic
No off target data available for this crispr