ID: 1008799705

View in Genome Browser
Species Human (GRCh38)
Location 6:55351484-55351506
Sequence CTTGCTGTGAAGAGCTTCTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 198}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008799705_1008799706 -4 Left 1008799705 6:55351484-55351506 CCAAAGAAGCTCTTCACAGCAAG 0: 1
1: 0
2: 0
3: 16
4: 198
Right 1008799706 6:55351503-55351525 CAAGACATGTGCAGTGAACATGG 0: 1
1: 0
2: 0
3: 17
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008799705 Original CRISPR CTTGCTGTGAAGAGCTTCTT TGG (reversed) Exonic
902641597 1:17769764-17769786 GTTGCTGTGTAGGGCTTCTTGGG + Intronic
903047331 1:20574690-20574712 GATGCTGGGAAGAGCATCTTAGG - Intergenic
904816384 1:33203949-33203971 CCTGCTGTGAAGAAGCTCTTTGG + Intergenic
904929223 1:34073087-34073109 ATTGCTGGGCAGGGCTTCTTGGG - Intronic
905298770 1:36971933-36971955 CTCTCTGTGAAGTGCTTCTGCGG + Intronic
906247202 1:44284642-44284664 CTGACTGTGGAGAGCTGCTTGGG - Intronic
908671816 1:66556397-66556419 CTTGCAGTGAAGAGCTGCCTAGG - Intronic
909048614 1:70740982-70741004 CTTGCTGTGTAGAACCTCTTAGG + Intergenic
909072957 1:71018065-71018087 CTTGCTGTAAAGAACTACCTGGG - Intronic
911516248 1:98871659-98871681 CTTGTGGTTAATAGCTTCTTGGG + Intergenic
917530441 1:175830215-175830237 CTTGCAGTTAAGAACTTCCTGGG + Intergenic
917803445 1:178592121-178592143 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
921439471 1:215167885-215167907 TTTGCTGTGAAGAAGCTCTTTGG - Intronic
922098961 1:222466407-222466429 CTTGCTTTGTAGAGCTTGTTGGG - Intergenic
923943380 1:238854767-238854789 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
924068530 1:240252519-240252541 TTTGCTGGGAAGAGTATCTTGGG + Intronic
924577488 1:245293515-245293537 CTGGTAGTGAAGAGATTCTTGGG + Intronic
1063508597 10:6624663-6624685 CTCCCTGGGAAGAGCTGCTTGGG + Intergenic
1064494220 10:15890793-15890815 CTTGCTGTTCACAGCTTCCTGGG - Intergenic
1067929764 10:50548722-50548744 TTTGCTGTGTAGAAGTTCTTTGG - Intronic
1071019394 10:81034300-81034322 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1072900542 10:99403172-99403194 TTTGCTGGGAATACCTTCTTGGG + Intronic
1072944547 10:99798158-99798180 CATGCTGTGAAAAGCTTACTTGG + Intronic
1073678659 10:105678385-105678407 TTTGCTGTGCAGAACCTCTTTGG + Intergenic
1073823082 10:107287790-107287812 ATTGCTGTGAAGAGTGTCATTGG + Intergenic
1077201764 11:1311111-1311133 CTTGTGGTTAATAGCTTCTTGGG - Intergenic
1079865836 11:25732645-25732667 CTTGCTGTGCAGAAGCTCTTGGG - Intergenic
1080152419 11:29068798-29068820 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1080728097 11:34916975-34916997 CATGCTGTGAAGGGCTTTCTTGG + Intronic
1085686355 11:78625464-78625486 GTTTCTGTGAAGAGCGTCATTGG + Intergenic
1085748944 11:79142598-79142620 ATTGCTGTGAAGAATGTCTTTGG - Intronic
1085881727 11:80475097-80475119 CTTGTGGGTAAGAGCTTCTTGGG - Intergenic
1086609845 11:88742603-88742625 CTTTCTGTGAAGAGCCTATGAGG + Intronic
1087550451 11:99641119-99641141 ATGGCTGTGAAGAGCTTGATCGG + Intronic
1087985945 11:104679696-104679718 CTGGGTGTGAAGAGTTGCTTTGG + Intergenic
1088759780 11:112918504-112918526 CTTTCTGTGGAGACTTTCTTTGG - Intergenic
1089571970 11:119417120-119417142 CTTGGTGAGAAGAGCTGCTGTGG - Intergenic
1091805120 12:3350424-3350446 CTTCCTCTGAACAGCTTCTCAGG - Intergenic
1094415879 12:30214316-30214338 CTTGTGGTTAATAGCTTCTTGGG + Intergenic
1094487803 12:30938735-30938757 CTTGCTCTGAGCAGCTTCTCGGG + Intronic
1095171088 12:39037356-39037378 CTTTCTCTTCAGAGCTTCTTTGG - Intergenic
1098326959 12:69312896-69312918 CTTGCTGTCAAGGGCTTTTGGGG - Intergenic
1098505621 12:71247103-71247125 ATTGCAGTGAAGCACTTCTTAGG + Intronic
1098560262 12:71864977-71864999 CTTGCTGTCAAGGGCTTTTGGGG + Intronic
1100513746 12:95305588-95305610 CATGCTGTTAAGAATTTCTTTGG + Intergenic
1100563116 12:95768926-95768948 TTTGCTTTGATGAGCTTCTCTGG + Intronic
1100826535 12:98479814-98479836 TCTGCTGTGAAGACCTTCATGGG - Intergenic
1100947019 12:99796979-99797001 GTTGCTGTAATTAGCTTCTTTGG + Intronic
1104936903 12:132369713-132369735 TTGGCTTTGCAGAGCTTCTTTGG + Intergenic
1106232369 13:27830530-27830552 CTTTCTGGGAAAAGCTACTTTGG + Intergenic
1108127880 13:47264230-47264252 CTGCCTTTGAACAGCTTCTTCGG + Intergenic
1108774863 13:53753344-53753366 CTTGAAGTGAAGAGATACTTGGG + Intergenic
1109368590 13:61391531-61391553 GTTGCAGAGAAGAACTTCTTTGG + Intergenic
1110064439 13:71086271-71086293 TTTGCTGTGCAGAAGTTCTTTGG + Intergenic
1110457393 13:75705007-75705029 CTTCCTATCAAGGGCTTCTTCGG + Intronic
1112471685 13:99695165-99695187 CCAGCTCTGAAGAGCTTCTTGGG - Intronic
1112733369 13:102392556-102392578 CTTGCTGTTAAAAGCTACCTCGG + Intronic
1113019861 13:105872881-105872903 ATTGCTATAAAGAGCTTATTGGG - Intergenic
1113865123 13:113516894-113516916 CTGGCAGTGATGAGCTTCTTAGG + Intronic
1116513532 14:45777748-45777770 ATTTCTGTGAAGAGTGTCTTTGG + Intergenic
1120393779 14:83942639-83942661 CTTGCTGTGTAGAAGCTCTTTGG + Intergenic
1124936181 15:34173511-34173533 CTTACTGTGAAGAAATTTTTGGG - Intronic
1124946683 15:34274355-34274377 CTTGCTGTTGACAGTTTCTTGGG - Intronic
1126817801 15:52471057-52471079 CTTGTTGTCCAGACCTTCTTGGG + Intronic
1127196316 15:56590312-56590334 TGTGCTGTGTAGAGCTTCTCTGG + Intergenic
1128552502 15:68607514-68607536 TTTTTTGTAAAGAGCTTCTTTGG + Intronic
1128738556 15:70067509-70067531 CTTGCTTTGGGGATCTTCTTAGG - Intronic
1132908376 16:2295931-2295953 CCTGCTGGGAAGAGCTGCTGGGG + Intronic
1133574304 16:7073356-7073378 TTTGTTGGGAAGATCTTCTTAGG - Intronic
1136265027 16:29111203-29111225 TTTCCTGTTAAGATCTTCTTCGG + Intergenic
1137848711 16:51716637-51716659 TTTGCTTTGATTAGCTTCTTTGG - Intergenic
1138137656 16:54537389-54537411 CTTCCTGAGAGGTGCTTCTTGGG + Intergenic
1143310732 17:5986588-5986610 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
1146291341 17:31609631-31609653 ATAGCTGTGAACAGCTTCTAGGG - Intergenic
1146623937 17:34421734-34421756 CTTTCTTGGAAGATCTTCTTAGG - Intergenic
1147331348 17:39700942-39700964 TTTGCTTTGAACAGATTCTTGGG + Intronic
1148463118 17:47849334-47849356 CTTGCTGTCAAGCTCTTCTCTGG - Intronic
1153472675 18:5464358-5464380 CTGGCTGTAAATACCTTCTTAGG - Intronic
1155943112 18:31819531-31819553 CATGCTGAGAAGAGCCTCTCAGG - Intergenic
1156157993 18:34326680-34326702 TTTGCTGTGCAGAGGCTCTTTGG - Intergenic
1157437440 18:47682716-47682738 CTTGCTCTGAAGATGGTCTTAGG + Intergenic
1158031916 18:52976324-52976346 TTTGCTGTGTAGAACTTCTTTGG + Intronic
1159766532 18:72497266-72497288 ATTTCTTTGAAGAGCTTCTCTGG + Intergenic
1164183454 19:22840094-22840116 TTTGCTGTGAAGAAGCTCTTTGG + Intergenic
1165030063 19:32991713-32991735 CTTGATGTGAAGGGCCTCATGGG - Intronic
1166010909 19:39941986-39942008 CTTGTGGTTAATAGCTTCTTGGG + Intergenic
929772584 2:44904694-44904716 CTTCCTGTGCAGAACTTCTGAGG + Intergenic
929817411 2:45245152-45245174 CTTGATGAGCACAGCTTCTTGGG + Intergenic
931578950 2:63752579-63752601 CTTCCAGTGAAGAGCTGCTCAGG + Intronic
932749577 2:74362885-74362907 ACTGCTGGGAAGAGCTTCTGTGG + Intronic
933505011 2:83165701-83165723 CTTCCTCTAGAGAGCTTCTTTGG + Intergenic
934479965 2:94628287-94628309 CTTGCTTTGAAGAGGTGATTAGG - Intergenic
937015828 2:118604551-118604573 CTTGCATTTAACAGCTTCTTGGG - Intergenic
937231547 2:120400875-120400897 CTGGCTGAGAAGAGCTTCCGGGG - Intergenic
938197449 2:129341652-129341674 CTCTTTGTGAAGAGCTTCTTGGG - Intergenic
938634245 2:133205644-133205666 AATGCTGTGAAAACCTTCTTGGG + Intronic
940195301 2:151087860-151087882 CCTGCTGTGCAAAGCTTCCTCGG + Intergenic
940400094 2:153238867-153238889 ATTGCTGTGAAGAATTTCATTGG + Intergenic
940681260 2:156787876-156787898 CTTGCTGTAAAGTCCTTCTGTGG - Intergenic
941622878 2:167798261-167798283 TTTGCTGTGAAGAAGCTCTTTGG + Intergenic
942153902 2:173107226-173107248 CTTGCTCTGCAGAGCTTGGTGGG - Intronic
946669905 2:222091433-222091455 CTTTCTGTGAAAAGGTTCTCCGG - Intergenic
947522321 2:230856692-230856714 TTTGGTGGAAAGAGCTTCTTTGG - Intergenic
948404506 2:237706933-237706955 CATGGTGTGAAGGGCCTCTTGGG - Intronic
1169799546 20:9500734-9500756 CTGGCTGGGAAGAGCCTCTCAGG - Intergenic
1170480785 20:16762956-16762978 CTTTCTCAGAAGAGCTTCCTAGG + Intronic
1171099968 20:22373784-22373806 CTTACTGTTAAGAGCTCCCTAGG - Intergenic
1173364639 20:42373894-42373916 CATGCTGTGAGGTGCTTCATTGG - Intronic
1173380920 20:42540331-42540353 CCTGCTGTGAACACTTTCTTAGG + Intronic
1173553420 20:43948958-43948980 CTTGCTGTGAAGAGCAATTGAGG + Intronic
1175593020 20:60208351-60208373 CTTAATGTGAAGAGTATCTTGGG + Intergenic
1177964175 21:27706296-27706318 TTTGCTGTGAAGAAGCTCTTTGG + Intergenic
1179174577 21:38998806-38998828 TTTGCTGTGCAGAGGCTCTTAGG + Intergenic
1180126089 21:45791131-45791153 CTTGTTGTGAGGGGCTTCCTGGG - Intronic
1181795000 22:25301473-25301495 CTGTCTGTGAAGAGGGTCTTTGG + Intergenic
1181835573 22:25605138-25605160 CTGTCTGTGAAGAGGTTCTTTGG + Intronic
1183933254 22:41248095-41248117 CATGCTGTCCAGAGCTTGTTTGG - Intronic
1184047339 22:41979638-41979660 CTGGCTGGGAACAGCTTCCTGGG + Intronic
949584873 3:5427729-5427751 CTTGCTGTGAAGAAATTCAGAGG + Intergenic
955449799 3:59053416-59053438 GTTGATGTGAATATCTTCTTTGG + Intergenic
955717741 3:61848181-61848203 CTGGCAGTGAAAAGCCTCTTAGG + Intronic
956235654 3:67068314-67068336 ATTGATGTGAGTAGCTTCTTTGG - Intergenic
960646609 3:119892037-119892059 CTTTTTGTGAGGTGCTTCTTGGG - Intronic
961487672 3:127227922-127227944 CAGGCTGTGAAGGGTTTCTTGGG + Intergenic
964311261 3:155395729-155395751 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
964314845 3:155432702-155432724 GTTGCTGTGAAGATATTTTTTGG - Intronic
964585795 3:158299858-158299880 CCTGCTGTGGAGAGCTTTCTGGG - Intronic
964851681 3:161102767-161102789 CATCCTGTTAAAAGCTTCTTTGG + Intronic
965318205 3:167217136-167217158 TTTGCTGTGGAGAAGTTCTTAGG - Intergenic
968694836 4:2019040-2019062 TCTGTTGTGAAGAGCTCCTTGGG + Intronic
971528495 4:27653797-27653819 CTTTCTGTGACTACCTTCTTTGG - Intergenic
971985825 4:33822595-33822617 ATTGCTGTGATTTGCTTCTTGGG - Intergenic
972911215 4:43819258-43819280 TTTGCTGTGCAGAACCTCTTTGG + Intergenic
975554273 4:75645298-75645320 TTTGATGTGAAAAGCATCTTTGG - Exonic
975835483 4:78418390-78418412 AATGCTCTGAAGAACTTCTTGGG + Intronic
976101628 4:81570221-81570243 CTTGCTGTCAATAGATACTTTGG - Intronic
976511870 4:85920544-85920566 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
978326912 4:107568789-107568811 ATTTCTGTGAAGAGCATCATTGG - Intergenic
979639680 4:122999285-122999307 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
979655417 4:123187237-123187259 GTAGCTGTGAAGAGCTATTTCGG - Intronic
981120087 4:141039727-141039749 CTTGCAGTTAATAACTTCTTGGG - Intronic
981133459 4:141184479-141184501 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
981439475 4:144766961-144766983 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
982011856 4:151113258-151113280 ACTGCTGTTAAGACCTTCTTAGG + Intronic
982059746 4:151592739-151592761 TTTGCTGTGCAGAAGTTCTTTGG + Intronic
982594065 4:157355015-157355037 CTTACAATTAAGAGCTTCTTGGG + Intronic
984273957 4:177585008-177585030 TTTACTTTGAAGAGATTCTTAGG - Intergenic
985970116 5:3369642-3369664 CTTGCTGTGCAGAAGTCCTTTGG + Intergenic
987456297 5:18151209-18151231 TTTGCTGTGAAGCCCTTCTAAGG + Intergenic
990300245 5:54442422-54442444 CTTGCTCAGAAGTGGTTCTTGGG - Intergenic
992076429 5:73196631-73196653 CTTGCTGTAATGAGCTTTCTAGG + Intergenic
992144948 5:73836637-73836659 TTTGCTGTGCAGAGATTTTTTGG + Intronic
993384384 5:87246925-87246947 ATTGCTGTGAAGAGATTTTAGGG + Intergenic
994438697 5:99772582-99772604 CTTACTGTGAATAGCTTCTAAGG - Intergenic
994860526 5:105186859-105186881 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
997032254 5:130144620-130144642 ATTTCTCTGAAGAGCTTCATTGG - Intronic
1000843273 5:166248315-166248337 GTGGATGTGAGGAGCTTCTTGGG - Intergenic
1003949053 6:11101467-11101489 GTTGCAGTGAAGAGGTTCTATGG + Intronic
1004171492 6:13298916-13298938 CTTCCTGAGAAGAGGTTTTTAGG - Intronic
1004914889 6:20322317-20322339 CTTGCTGTGAATGCCTTCTCTGG - Intergenic
1007467296 6:42062943-42062965 CTTCCTGTGGCCAGCTTCTTAGG + Intronic
1007742349 6:44020601-44020623 CCTGCTGGGAAGAGGCTCTTTGG + Intergenic
1007861029 6:44908667-44908689 CTTGCAGTGAAGACTTTCTGGGG - Intronic
1008799705 6:55351484-55351506 CTTGCTGTGAAGAGCTTCTTTGG - Exonic
1010783977 6:79978460-79978482 ATTGCTGTGCAGAACCTCTTGGG - Intergenic
1012520822 6:100119001-100119023 CTTTCTGAGAAGTGCTGCTTTGG - Intergenic
1012917092 6:105181771-105181793 CTTGCAGTTAACAGCTTCTTGGG + Intergenic
1013338004 6:109184949-109184971 CTTGCTGTTAATAACTCCTTGGG + Intergenic
1013585267 6:111572654-111572676 CTTGCTGTTCAGAGGTACTTGGG + Intronic
1014968335 6:127783403-127783425 TTTGCTGTGCAGAAGTTCTTTGG - Intronic
1016567358 6:145471587-145471609 CATGGTGTGAAGAGCCTCTATGG + Intergenic
1017739015 6:157388822-157388844 ATTGATGTGATGTGCTTCTTGGG - Intronic
1018442584 6:163826514-163826536 CTTACTGGGAAGAGCATTTTAGG - Intergenic
1020674424 7:11164183-11164205 CCTGCTGTGAAGAACATATTTGG + Intronic
1021485268 7:21160940-21160962 CTCTCAGTGAAGAGCTTCTTAGG + Intergenic
1021558162 7:21942828-21942850 CTTTCTGTGACCAGCTTCTGGGG + Intronic
1021843110 7:24738595-24738617 ATTGCTGTGAAGAACATCATTGG - Intronic
1024860013 7:53827865-53827887 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1029654432 7:101914865-101914887 CTTGCTGGGAAATGCTTCCTTGG - Intronic
1030892243 7:115013118-115013140 ATTGCTGTGAGTAGCATCTTCGG - Intronic
1035349217 7:158233591-158233613 CTTTCTGTGAAGAGTGTCATTGG - Intronic
1036010609 8:4717826-4717848 CTTAATGTGAAGAGATTCCTGGG - Intronic
1038378450 8:27067937-27067959 TTTGCTGTGCAGAGCTTTTAAGG + Intergenic
1038404038 8:27308830-27308852 CTTGCTGTGAACAGCAGCTGGGG - Intronic
1043000150 8:74748764-74748786 CTTGCTGTGAAGAACTGCTGTGG + Intronic
1044296185 8:90529952-90529974 CTTACTGTAAAGAGCTAATTTGG + Intergenic
1044389738 8:91635939-91635961 CTTGCTGTTAAGAACTACTATGG - Intergenic
1046409476 8:113820624-113820646 TTTGCTGTGCAGAAATTCTTTGG - Intergenic
1047294344 8:123557948-123557970 CCTGCTGTGAAGATCTTCCTCGG + Intergenic
1049000746 8:139824315-139824337 CTTCCTGTGCAGAGCTTCGGGGG + Intronic
1049979093 9:887426-887448 CTTGCTCTGAAAACCTTCATTGG + Intronic
1052119960 9:24702338-24702360 CTTGCTGAGAAAAGCAGCTTTGG - Intergenic
1052822008 9:33145028-33145050 CTTGCTGTGAAGACCTCGTCTGG - Intronic
1055908218 9:81317938-81317960 CTTGCAGTGATGAAATTCTTCGG - Intergenic
1056216081 9:84407370-84407392 CTAGCTGAGAACAGCTTCTAGGG + Intergenic
1057345061 9:94242864-94242886 ATTGCTGTGCAGAAATTCTTTGG + Intergenic
1059516603 9:114901742-114901764 CTTTCTGTGAGTAGATTCTTTGG - Intronic
1186947712 X:14587765-14587787 TTTGCTGTGAAGAAGCTCTTTGG + Intronic
1187088761 X:16070937-16070959 CGTTCTGTGAAGAACATCTTTGG + Intergenic
1188381660 X:29501274-29501296 TTTGCTGTGCAGAGCTTTTTAGG + Intronic
1188799105 X:34504849-34504871 TTTGCTGTGCAGAAGTTCTTTGG + Intergenic
1188831565 X:34904504-34904526 CTTTCTGTGAAGAGCATCATTGG - Intergenic
1188929355 X:36087365-36087387 ATTTCTGTAAAGAGATTCTTTGG + Intronic
1191611806 X:63123683-63123705 ATTGCTGTGTAGAGTATCTTTGG - Intergenic
1191979536 X:66910761-66910783 CTTGCTGTGTAGAAACTCTTAGG - Intergenic
1192883618 X:75314494-75314516 TTTGCTGTGAAGAAGCTCTTTGG + Intergenic
1193663017 X:84280161-84280183 TTTGCTGTGCAGAAGTTCTTAGG + Intergenic
1193871974 X:86809619-86809641 CTTGGTGTGAAAAGCATGTTTGG + Intronic
1194031260 X:88818764-88818786 TTTGCTGTGCAGATGTTCTTTGG + Intergenic
1194396823 X:93396068-93396090 CACGCTGTGAAGAGCATCTCTGG - Intergenic
1194984328 X:100473815-100473837 TTTGCTGTGCAGAAGTTCTTTGG - Intergenic
1195501464 X:105605564-105605586 ATTTCTGTGAAGAACTTCATTGG - Intronic
1197363311 X:125533558-125533580 CTTGTTGTGGAGAGCCTCTCTGG - Intergenic
1197542637 X:127784435-127784457 TATTCTGTGAAGAACTTCTTTGG + Intergenic
1201970122 Y:19782955-19782977 CTTGCTGTGTAGAATCTCTTTGG - Intergenic