ID: 1008801860

View in Genome Browser
Species Human (GRCh38)
Location 6:55378244-55378266
Sequence CATTCTATGAAGAATTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 693
Summary {0: 1, 1: 1, 2: 1, 3: 53, 4: 637}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008801858_1008801860 24 Left 1008801858 6:55378197-55378219 CCAAGATGAAGCACTCTTAGGTT 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1008801860 6:55378244-55378266 CATTCTATGAAGAATTTTGATGG 0: 1
1: 1
2: 1
3: 53
4: 637

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008801860 Original CRISPR CATTCTATGAAGAATTTTGA TGG Intronic
900006305 1:55746-55768 CACTGAATGAAAAATTTTGAGGG - Intergenic
902175274 1:14645326-14645348 AGTTCTATGAAGAATGTTGGTGG + Intronic
905962411 1:42054799-42054821 AATTCTATGAAGAATGTCAATGG + Intergenic
905978257 1:42197154-42197176 CATTGTATGCAGAGTTTTGAGGG - Intronic
906321061 1:44815899-44815921 TATTCCATGAAGAGTTTTAAAGG + Intergenic
908606749 1:65805754-65805776 CATTTTACTCAGAATTTTGAAGG + Intronic
908866284 1:68552343-68552365 AATTCTGTGAAGAATATTGATGG - Intergenic
909049147 1:70747436-70747458 AGTTCTATGAAGAATTTCCATGG + Intergenic
909064788 1:70922423-70922445 CATTTTATGAAGCATTTAGGAGG - Intronic
909210132 1:72812815-72812837 CATTTTATGAAGCATTTAGGAGG + Intergenic
909839202 1:80296903-80296925 CATTCAATGTAAATTTTTGAGGG - Intergenic
909988322 1:82190224-82190246 GATTAAATGGAGAATTTTGAGGG - Intergenic
910172696 1:84394862-84394884 CATTCTGTGAGGATTTTTGAGGG - Intergenic
910653231 1:89592370-89592392 CTTTTTATGAAGACTCTTGAGGG + Intronic
910888989 1:91997318-91997340 CATTCTTTGAAGAACTTTGTTGG + Intronic
911785092 1:101936572-101936594 AATTCTGTGAAGAATGTTGTTGG - Intronic
911800603 1:102133222-102133244 AATTATGTGAAGAATGTTGATGG - Intergenic
912203394 1:107483776-107483798 CCTTCTATCAATAATATTGATGG + Intergenic
912341872 1:108924495-108924517 CTTGCTATGAAGAACTTTAAAGG + Intronic
912956936 1:114161012-114161034 AATTCTATGAAGGATTTTAACGG - Intergenic
913311075 1:117494251-117494273 CATTCTAGGAAGAATTTATATGG + Intronic
915417869 1:155756190-155756212 CATTCTGGGAAGTATTTTAATGG - Intronic
916142035 1:161708324-161708346 GCTTCTATGAACAATTTAGAAGG - Intronic
916640319 1:166721399-166721421 CATTTTATGAAGCATTTAGGAGG - Intergenic
917046716 1:170868711-170868733 AATTCTATGAAGAATGTCAATGG + Intergenic
917053819 1:170956341-170956363 AATTCTATGAAGAATGTTGGTGG + Intronic
917149977 1:171932523-171932545 CATCCTATTAAAATTTTTGATGG + Intronic
917245830 1:172999243-172999265 CATACAATGAAGGATTGTGATGG - Intergenic
917293740 1:173497012-173497034 CATTTTATGAAGCATTTAGGAGG - Intergenic
918172269 1:182009831-182009853 AATTCTGTGAAGAATGATGATGG - Intergenic
918589575 1:186225260-186225282 CATTTTATGAAGCATTTAGGAGG - Intergenic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
918782499 1:188719454-188719476 AATTCTGTGAAGAATGATGATGG + Intergenic
918958972 1:191246258-191246280 AATTCTATGAAGAATGTTACTGG + Intergenic
918972513 1:191437900-191437922 AGTTCTATGAAGAATGATGATGG - Intergenic
919032288 1:192258159-192258181 CTTTTTAAGAATAATTTTGAGGG - Intergenic
919037101 1:192327055-192327077 CATTCTATTATTATTTTTGAAGG - Intronic
920989218 1:210920424-210920446 CATAATATGAAAAATTTTAAGGG + Intronic
921077299 1:211710385-211710407 CATTTTATGAAGCATTTAGGAGG - Intergenic
921858052 1:220010112-220010134 AATTCTATTCAGAATTTAGATGG + Intronic
922033641 1:221827350-221827372 CATTCTTGGAAGAGTTTTGTTGG + Intergenic
922377563 1:224984008-224984030 AACTCTGTGAAGAATTATGATGG - Intronic
922658310 1:227405691-227405713 AATTCTATGAAGAATGATGGTGG - Intergenic
924046896 1:240041082-240041104 CTTTCTCAGAAGAATTTTTAGGG + Intronic
924329357 1:242926559-242926581 CATTCCAAGAAGCATTTTGTGGG + Intergenic
924392357 1:243576841-243576863 AATTCTGTGAAGAATTTCCATGG - Intronic
924745961 1:246833875-246833897 GATAGTATGAATAATTTTGATGG - Intergenic
1064797599 10:19030605-19030627 CATTCTTAGAACAATTGTGAAGG - Intergenic
1066087707 10:31987128-31987150 AATTCTGTGAAGAATATTAATGG - Intergenic
1066699304 10:38109957-38109979 AATTCTGTGAAGAATGTTAATGG - Intronic
1067236611 10:44456077-44456099 AATTCTATGAAGAATGTCAATGG + Intergenic
1067259247 10:44673538-44673560 CATTCCATCTAGATTTTTGAAGG - Intergenic
1067413153 10:46082740-46082762 AATTCTGTGAAGAATGTCGATGG + Intergenic
1067762005 10:49055440-49055462 CATTATGTGCAGAATCTTGAAGG + Intronic
1068198635 10:53752002-53752024 CATTTTATGTTAAATTTTGAAGG - Intergenic
1068316203 10:55346483-55346505 CATTCTATGATAAATTTTGCTGG - Intronic
1068481133 10:57589894-57589916 AATTCTGTGAAGAATTATGGTGG - Intergenic
1068611650 10:59066951-59066973 CACTCTATGAAGAATTTGGAGGG - Intergenic
1071016373 10:81001851-81001873 AATGCAATGAAAAATTTTGATGG - Intergenic
1071195031 10:83148806-83148828 AATTCTGTGAAGAATGTAGATGG - Intergenic
1071768603 10:88698927-88698949 AATTCTATGAGGAAATTTCATGG + Intergenic
1071913643 10:90265354-90265376 AATTCTATGAAGAATGTCAATGG - Intergenic
1073531286 10:104233944-104233966 CATTGTATGAAGCATTTAGGAGG - Intergenic
1073717024 10:106119237-106119259 AATTCTATGAAGAATGTCAATGG - Intergenic
1073910177 10:108332874-108332896 AATTCTATGAAGAATATTAATGG + Intergenic
1073965641 10:108986314-108986336 CTTTCTATGAATGTTTTTGATGG - Intergenic
1075494161 10:122905009-122905031 AATTCTGTGAAGAATGGTGATGG - Intergenic
1076298733 10:129407516-129407538 CATCCTATGGAGATTTTGGACGG - Intergenic
1077989927 11:7397158-7397180 CTTTGTATGAAGGATTTTAATGG - Intronic
1078208791 11:9253364-9253386 CCTTCTATGAAGAAAATTGCAGG + Intronic
1078289022 11:9987884-9987906 AATTCTGTGAAGAATGATGATGG - Intronic
1078958584 11:16234157-16234179 CATTCTATAAACATTTTTAAAGG + Intronic
1079255590 11:18825970-18825992 AATTCTGTGAAGAATGATGATGG + Intergenic
1079463870 11:20709565-20709587 AGTTCTGTGAAGAATTTTGATGG + Intronic
1079705732 11:23615463-23615485 AATTCTATGAAGAATGTCAATGG + Intergenic
1080141837 11:28931035-28931057 CATTGTATGAGGAAGTTTGGCGG + Intergenic
1080238133 11:30095770-30095792 AATTCTATGAAGAACATTAATGG + Intergenic
1080513270 11:32996543-32996565 TATTCTGTGAAGAATGTTAATGG + Intergenic
1080781187 11:35431504-35431526 CATTCCATGAAGATTTATGGAGG + Intergenic
1081355249 11:42104792-42104814 AATTTTTTGTAGAATTTTGATGG - Intergenic
1081798252 11:45837632-45837654 AATTCTATGAAGAAAGTCGATGG - Intergenic
1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG + Intergenic
1082746014 11:56963978-56964000 AATTCTGTGAAGAATTTCAATGG + Intergenic
1082866624 11:57905713-57905735 CATTTTATGAAGCATTTAGGAGG + Intergenic
1085480076 11:76814539-76814561 CATTTTATGAAGCATTTAGGTGG + Intergenic
1085917543 11:80907640-80907662 AATTCTGTGAAGAATGGTGATGG - Intergenic
1085961632 11:81469061-81469083 CACTTTATGAACAAATTTGAAGG - Intergenic
1085974688 11:81638005-81638027 CATTTTATGAAGCATTTAGGAGG - Intergenic
1086762439 11:90649373-90649395 TATTCTGTGAAGAATTTCAATGG - Intergenic
1087294045 11:96348975-96348997 AATTCTGTGAAGAATGTTAATGG + Intergenic
1087296723 11:96386163-96386185 CATTTTTTGAAGATTTTTAATGG - Intronic
1087352391 11:97048377-97048399 AATTCTATGAACAACTCTGAAGG - Intergenic
1087442434 11:98203493-98203515 CATTCTGTGAAGAATGTCAATGG - Intergenic
1087555936 11:99721104-99721126 AGTTCTGTGAAGAATTCTGATGG - Intronic
1087677163 11:101176204-101176226 CATTCTATAAAGACTGTTAAAGG - Intergenic
1087984318 11:104658652-104658674 CATTCATTGAACTATTTTGAAGG - Intergenic
1088461390 11:110087028-110087050 GATTATATGAAGATTTTTGTTGG - Intergenic
1089030207 11:115318706-115318728 AAATCCATGAAGAATTTTGCAGG + Intronic
1090232315 11:125117010-125117032 CCTTCTATAAAGGATTTTGGAGG + Intergenic
1090584539 11:128196673-128196695 CAATCTATGAGAAACTTTGATGG + Intergenic
1091725395 12:2843118-2843140 CATTCTATAAAGAATATTCCGGG - Intronic
1092075419 12:5669072-5669094 AATTCTGTGAAGAATTTCAATGG + Intronic
1092456439 12:8647787-8647809 CATTCTATGTACAATTTCAAGGG - Exonic
1093369320 12:18347996-18348018 AATTTTATGAAAAATTTTAAAGG + Intronic
1093505265 12:19857894-19857916 CATGCCATGAAGTATTTTAAGGG + Intergenic
1093671077 12:21876865-21876887 CATTTTATGAAGGGTTTTGGGGG - Intronic
1093808875 12:23468853-23468875 AATTCTGTGAAGAATGTTAATGG - Intergenic
1094149410 12:27266259-27266281 CACATTATGAAGAATTTTGTAGG + Intronic
1094262651 12:28519072-28519094 AATTCTGTGAAGAATGTTGGTGG + Intronic
1094737838 12:33255172-33255194 CCTTATCTGAAGAATTTAGAAGG - Intergenic
1095620644 12:44249457-44249479 AATTCTGTGAAGAATTTCAATGG - Intronic
1096051252 12:48610509-48610531 AATTCTATGAAGAATCTCAATGG + Intergenic
1097389077 12:58986963-58986985 AATTCTGTGAAAAATTTTGTTGG + Intergenic
1097499342 12:60382499-60382521 AATTCTGTGAAGAATTTCAATGG + Intergenic
1097906566 12:64925882-64925904 AGTTCTATGAAGAATGATGATGG + Intergenic
1098616675 12:72534683-72534705 AATTCTAAGAAAAATTTTGATGG + Intronic
1098688958 12:73463019-73463041 GATTCTGTGAAGAATGTTAATGG + Intergenic
1098876897 12:75875084-75875106 CTTTCTGTGAAGAATGATGATGG - Intergenic
1099138699 12:78942206-78942228 GATTCAATGAATAATTTTAAAGG - Intronic
1099411306 12:82331722-82331744 TATTTTATGAAGCATTTTAAAGG + Intronic
1099486767 12:83238450-83238472 AATTCTATGAAGAATGTCAATGG + Intergenic
1099687253 12:85906395-85906417 CATTCTGTGAAGAATGATGGTGG + Intergenic
1099898922 12:88682963-88682985 CATTCTATCAATTATTTTGAAGG + Intergenic
1100621153 12:96274533-96274555 CATTCTATGAAAAATATTGTTGG - Intergenic
1100779843 12:98012333-98012355 CTTTCCAAGAACAATTTTGATGG + Intergenic
1100815398 12:98382157-98382179 AATTCTGTGAAGAATGTTAATGG - Intergenic
1100950593 12:99844761-99844783 AATTCTATGAAGAATGTCAATGG + Intronic
1101192271 12:102347347-102347369 TATTCTAGGGAGAAATTTGAAGG + Intergenic
1101307941 12:103548769-103548791 CATCCTCTGAGTAATTTTGATGG + Intergenic
1101634893 12:106531297-106531319 AATTCTGTGAAGAATGATGATGG + Intronic
1101757019 12:107629113-107629135 TATGCTATTAAGAATTTTGCAGG + Intronic
1104520408 12:129469297-129469319 CATCCTATGAATAAGTTTTAAGG - Intronic
1105710667 13:23005748-23005770 CTTATTATGAATAATTTTGAGGG - Intergenic
1105835295 13:24205549-24205571 AATTCTGTGAAGAATGTTAATGG - Intronic
1105931177 13:25053975-25053997 AATTCTATGAAGAATGATGGTGG - Intergenic
1106388161 13:29308048-29308070 CATTCTGTGAAGAATGTCAATGG - Intronic
1106395292 13:29373983-29374005 CTTTCTTTGAAGAATTTCAAGGG - Intronic
1106605106 13:31221783-31221805 CAGTCTGTGAAGAAAATTGAAGG + Intronic
1108130777 13:47297848-47297870 AATTCTGTGAAGAATGTTGTTGG + Intergenic
1108288629 13:48934575-48934597 AATTCTGTGAAGAATTATGGTGG + Intergenic
1108764888 13:53615237-53615259 ATTTCTAAGAAGAATTTTAATGG - Intergenic
1109555221 13:63965422-63965444 TATTATGTGAAGAATTTTGAGGG + Intergenic
1109567845 13:64141729-64141751 AATTTTGTGAAGAATTATGATGG - Intergenic
1109703012 13:66051077-66051099 CAATCTAAAAAGAATTTAGATGG + Intergenic
1109895615 13:68685004-68685026 CTTTTTTTCAAGAATTTTGAAGG - Intergenic
1109908662 13:68879757-68879779 AATTATATGAAGCATTTTGTGGG - Intergenic
1109928286 13:69177485-69177507 AATTCTATGAAGAATGATGTGGG - Intergenic
1110010545 13:70327487-70327509 CATTCTGTGAAGAATGTGAATGG + Intergenic
1110110657 13:71741560-71741582 AATTTTATCAAGCATTTTGAGGG - Intronic
1110661987 13:78067279-78067301 CATTCTATTTAGAATCTGGATGG + Intergenic
1110671277 13:78181836-78181858 AAGTCACTGAAGAATTTTGATGG + Intergenic
1111091244 13:83451031-83451053 TATCATATGAATAATTTTGACGG + Intergenic
1111508587 13:89229605-89229627 AATTCTATGAAGAATGATGTTGG + Intergenic
1111699735 13:91671692-91671714 AATTCTGTGAAGAATGTTAATGG - Intronic
1112081506 13:95976669-95976691 AATTCTGTGAAGAAAGTTGATGG - Intronic
1112569056 13:100577543-100577565 TATTTTATTATGAATTTTGAGGG - Intronic
1112661492 13:101514179-101514201 CATTGTATGAAGAAGTGTGTTGG + Intronic
1113330438 13:109321644-109321666 AATTCTGTGAAGAATTATGGTGG - Intergenic
1114505088 14:23204748-23204770 AATTCTATGAAGAATGATGGTGG + Intronic
1114640941 14:24220240-24220262 CAGTCAATGAATATTTTTGAAGG + Intronic
1115130118 14:30044846-30044868 AATTCTATGAAGAATGATGGTGG - Intronic
1115858867 14:37661696-37661718 AATTCTGTGAAGAATTTCAATGG + Intronic
1115924612 14:38417089-38417111 AATTCTGTGAAGAATGTTAATGG - Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1116652458 14:47610824-47610846 AATTCTGTGAAGAATTATGGTGG - Intronic
1116693292 14:48139040-48139062 CATTCTAGAAAGAATTATCATGG + Intergenic
1116727738 14:48583515-48583537 AAGTCTATGAATAATTGTGAAGG + Intergenic
1116757520 14:48966220-48966242 AGTTCTATGAAGAGTTTAGAAGG - Intergenic
1116924789 14:50623420-50623442 CATTGTGTGCACAATTTTGAAGG + Intronic
1116939471 14:50776319-50776341 AATACTAAGAAGAGTTTTGAAGG - Intronic
1117080438 14:52146373-52146395 AATTCTGTGAAGAATGTTAATGG + Intergenic
1117223107 14:53627118-53627140 CTTTCTTTGAAGAATTGTAACGG + Intergenic
1117940819 14:60962457-60962479 TATTCTATGAACAATGTTGTTGG - Intronic
1117965682 14:61204805-61204827 CATTCTATCTAGAATTATGGAGG + Intronic
1118061884 14:62148389-62148411 AATTCTGTGAAGAATGATGATGG - Intergenic
1118118439 14:62807882-62807904 CATTTTATGAAGCATTTAGGAGG - Intronic
1118665222 14:68061777-68061799 CATTCTAAGAGGTTTTTTGATGG + Intronic
1118701343 14:68436545-68436567 AATTCTGTGAAGAATTATGTTGG + Intronic
1120152370 14:81051334-81051356 ACTTCTATGGATAATTTTGAGGG - Intronic
1121725697 14:96147869-96147891 CTTTCTATGATGAATTTTCCAGG + Intergenic
1121947779 14:98139206-98139228 AAATGTAGGAAGAATTTTGATGG - Intergenic
1123103882 14:105827151-105827173 AATTCTGTGAAGAATGATGATGG + Intergenic
1123586749 15:21767456-21767478 AATTCTGTGAAGAATTTCAATGG - Intergenic
1123623388 15:22210021-22210043 AATTCTGTGAAGAATTTCAATGG - Intergenic
1124191888 15:27586067-27586089 CCTTCTATGACCAATTTTAATGG - Intergenic
1125035147 15:35115175-35115197 CATCCTAGGAAGATTTTTAAAGG - Intergenic
1125092322 15:35808837-35808859 AATCCTATAAAGACTTTTGAAGG + Intergenic
1125127737 15:36243937-36243959 AATTCTATGAAGAATGTCAATGG - Intergenic
1125913842 15:43466877-43466899 CATGCTATGTAGAATTATGGAGG + Intronic
1126737454 15:51746047-51746069 CTTTATATGAAGCATATTGAGGG - Intronic
1126784749 15:52168583-52168605 TATTCTATGAAGAATGTCAATGG - Intronic
1126969497 15:54094566-54094588 AATTCTAAAAACAATTTTGAAGG - Intronic
1126997074 15:54456378-54456400 AATTCTGTGAAGAATGATGATGG + Intronic
1127338676 15:58017496-58017518 AATGCTATGGAGAAATTTGAGGG - Intronic
1127368942 15:58318103-58318125 AGTTTTATGCAGAATTTTGACGG + Intronic
1127863919 15:63016301-63016323 CCTTCTAAGAAGAAGTTTGCTGG - Intergenic
1128004232 15:64223403-64223425 CTTTCTATAAATAATTATGAGGG + Intronic
1129855368 15:78820802-78820824 CATTCTCCCTAGAATTTTGAAGG - Intronic
1130007879 15:80118856-80118878 CATTATCTGAAGACTGTTGATGG - Intronic
1130234604 15:82122522-82122544 CATTCTGGGCAGAATGTTGATGG - Intergenic
1130621551 15:85468149-85468171 TATTCTATGAAGACTTATTAAGG + Intronic
1130758514 15:86792530-86792552 CATATTATGAAGAAATTTGTTGG + Intronic
1131389886 15:92038718-92038740 AATTCTATGAAGAATATCCATGG - Intronic
1131917803 15:97289932-97289954 AATTCTGTGAAGAATGTTGTTGG + Intergenic
1132035795 15:98483112-98483134 AATGCTATGAAGAATGTGGATGG - Intronic
1132433308 15:101777716-101777738 CGTTCTCTCAAGTATTTTGAAGG - Intergenic
1132447217 15:101935212-101935234 CACTGAATGAAAAATTTTGAGGG + Intergenic
1138832158 16:60387562-60387584 CATTCTGTGAAGAATGTCAATGG + Intergenic
1139320000 16:66106678-66106700 CATTCTATGAAGGAATAGGATGG - Intergenic
1139541387 16:67619882-67619904 GATTCTATGAAGTGCTTTGAGGG - Intronic
1140319449 16:73934605-73934627 CATTCTGTGAAGAATGTCAATGG - Intergenic
1140574547 16:76150533-76150555 TATACTATGAAGCATTTTGGAGG - Intergenic
1140916706 16:79500304-79500326 CATCCCATGAAGAATGTTGGTGG - Intergenic
1143278001 17:5728516-5728538 AATTCTGTGAAGAATGATGATGG - Intergenic
1143333727 17:6157486-6157508 AATTGTATTAAGAATCTTGATGG - Intergenic
1144551923 17:16248332-16248354 AATTCTAAGTAAAATTTTGAAGG - Intronic
1148380419 17:47192735-47192757 CATTGTTTGAAGTACTTTGATGG + Intergenic
1148707947 17:49652376-49652398 CATTCAATGAATATTTTTTATGG - Intronic
1149154891 17:53616417-53616439 CATTATTTGGAGACTTTTGAAGG + Intergenic
1150022509 17:61632332-61632354 CTTTCTGTGAAGAATGTTGTTGG + Intergenic
1151207449 17:72518458-72518480 CATTCAATAAAGATTTTTAAAGG + Intergenic
1153578276 18:6544813-6544835 TATTTTAAGAAGAAATTTGAAGG - Intronic
1153863482 18:9238061-9238083 AATTCTATGGAGAATTTCAAAGG - Intronic
1155260373 18:24036597-24036619 CATTCCTTGTAGAATTTTTAGGG + Intronic
1155739976 18:29277502-29277524 CATTTTATGAAGAATTGAGATGG - Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1156095649 18:33528397-33528419 AGTTCTGTGAAGAATTATGATGG + Intergenic
1156386257 18:36607720-36607742 AATTCTAAGAAAAATATTGAAGG - Intronic
1156665052 18:39394690-39394712 AATTCTGTGAAGAATGTCGATGG - Intergenic
1156824347 18:41412463-41412485 CATTCTGTGAAGAATGTCAATGG - Intergenic
1156976264 18:43225194-43225216 AATTCTGTGAAGAATGATGATGG + Intergenic
1158002994 18:52640831-52640853 AATTCTATGAAGAATGATGGTGG - Intronic
1158230847 18:55253011-55253033 TATTCAATGATGAATTTTTAGGG + Intronic
1158766842 18:60460957-60460979 CATTCTATGACAAATTTTTATGG + Intergenic
1158921207 18:62192907-62192929 AATTCTATGAAGAATGTCAATGG + Intronic
1159231703 18:65616386-65616408 AATTCTATGAAGAATTTCATTGG + Intergenic
1159632733 18:70767620-70767642 CATTCTGTGAAGAATGTGAATGG - Intergenic
1159727870 18:71985139-71985161 CATTTTGTTAAGAGTTTTGATGG + Intergenic
1160638059 19:97321-97343 CACTGAATGAAAAATTTTGAGGG - Intergenic
1164022973 19:21325185-21325207 AATTCTGTGAAGAATTATGGTGG - Intronic
1164135263 19:22408902-22408924 AATTCTGTGAAGAATGTTAATGG - Intronic
1164470493 19:28526193-28526215 CATTTTATGAAGGATTTAGGAGG - Intergenic
1165681052 19:37776100-37776122 AATTCTGTGAAGAATGGTGATGG - Intronic
925321338 2:2971777-2971799 CATTCCAGGAAGAAATTGGAGGG - Intergenic
926474983 2:13310505-13310527 AATTCTGTGAAGAATTTCAAAGG + Intergenic
926521828 2:13924999-13925021 CATTTTATGAAGCATTTAGGAGG - Intergenic
926560551 2:14412632-14412654 AATTCTGTGAAGAATGATGATGG - Intergenic
926715565 2:15921308-15921330 CTTTCACTGAAGAACTTTGAGGG + Intergenic
926999294 2:18775710-18775732 AATGCTATAAAGAATTTTGTTGG + Intergenic
927021806 2:19024847-19024869 AATTCAATGATGAATTTTAAGGG - Intergenic
927568022 2:24131353-24131375 AATTCTATGAAGAATGTCAATGG + Intronic
928044722 2:27917656-27917678 GATTCCAATAAGAATTTTGAGGG + Intronic
928354443 2:30597168-30597190 AATTCTATGAAGAATGTCAACGG + Intronic
928355176 2:30606205-30606227 AATTCTATGAAGAATGTCAACGG - Intronic
928900460 2:36312408-36312430 AATTCTGTGAAGAATGTTAATGG - Intergenic
928910442 2:36415550-36415572 GAATCTATGAACAATTTTAAAGG - Intronic
929663011 2:43808224-43808246 GATTCTAGGAAGAATTTTCATGG - Intronic
930504577 2:52266717-52266739 CATTTTATGAAGCATTTAGGAGG - Intergenic
931211625 2:60202454-60202476 AATTCTGTGAAGAATTTCAAGGG + Intergenic
931445637 2:62324887-62324909 CATTCTATGAATATTCATGAGGG + Intergenic
931998022 2:67857568-67857590 TATTCAATCAAGAAGTTTGATGG - Intergenic
932100179 2:68891832-68891854 AATTCTGTGAAGAATTATGGTGG + Intergenic
932420992 2:71601255-71601277 CATACTAAGAGGAAGTTTGAAGG - Intronic
932871023 2:75398183-75398205 AATTCTGTGAAGAATGATGATGG - Intergenic
932941592 2:76173061-76173083 CATTCTGTGAAGAATGTCAATGG + Intergenic
933404248 2:81838106-81838128 AATTCTGTGAAGAATGTTAAAGG + Intergenic
933628784 2:84633069-84633091 CATTCTATGAAGAAGCCTGCTGG - Intronic
934310233 2:91856485-91856507 AATTCTTTGAAGAATGATGATGG - Intergenic
934549461 2:95246972-95246994 AATTCTGTAAAGAATGTTGATGG - Intronic
934889086 2:98050243-98050265 CATTTTATGAAGCATTTACAAGG - Intergenic
935003049 2:99040733-99040755 GGTTCTATGAAGAATGATGATGG - Intronic
935436621 2:103042461-103042483 AATTCCATGAAGAATGTTGGCGG - Intergenic
936877569 2:117210385-117210407 AATTCTATGAAGAATGTCAATGG - Intergenic
937716044 2:125034005-125034027 CCTTCTATGCATATTTTTGAGGG + Intergenic
937798573 2:126054505-126054527 AATTCTATGAAGAGTGATGATGG + Intergenic
938649078 2:133362556-133362578 CATTCTAGAAATATTTTTGAGGG - Intronic
938817654 2:134919744-134919766 CATTCCCAGAACAATTTTGATGG - Intronic
938983202 2:136546280-136546302 CACTCTGTGAAGATTTATGAGGG - Intergenic
939021897 2:136967206-136967228 CTTTCTTTGAAGGACTTTGAAGG - Intronic
939110116 2:137996637-137996659 AATTCTGTGAAGAATGTCGATGG - Intronic
939252721 2:139703573-139703595 CATTTTATGAAGAACTATTATGG - Intergenic
939835757 2:147127164-147127186 CATTCTGTGAAGAATGATGATGG + Intergenic
939954794 2:148518790-148518812 GCTTATATGAAGAATTTTGCTGG - Intergenic
940687863 2:156876550-156876572 CATGCTGTGAAAAATTATGATGG + Intergenic
941061030 2:160847344-160847366 AATTCTGTGAAGAATGATGATGG - Intergenic
941156563 2:161986322-161986344 CATTCCATGAAGAACATCGAAGG - Intergenic
941627814 2:167849196-167849218 AATTCTATGAAGAATGATGGTGG - Intergenic
941743295 2:169059528-169059550 AGTTCTATGAAGAATATTAATGG - Intergenic
942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG + Intergenic
942166200 2:173243421-173243443 CTTTCTTGGAATAATTTTGAGGG + Intronic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
942743976 2:179211276-179211298 AATTCTGTGAAGAATGATGATGG - Intronic
943350359 2:186789942-186789964 AATTCTGTGAAGAATTTCAATGG - Intergenic
943539094 2:189189337-189189359 CATACTATAAAGAATTGTAATGG - Intergenic
943714842 2:191139719-191139741 AAATCTATGAAGAATGATGATGG - Intronic
943899014 2:193408045-193408067 AATTCTGTGAAGAATTTCAATGG - Intergenic
943960798 2:194260999-194261021 CACTATATAAAGAATTTTAAAGG - Intergenic
944035942 2:195294706-195294728 AATTCTATGAAGAATGTCAATGG - Intergenic
944113930 2:196167123-196167145 CATTCTGTGTTGAGTTTTGAAGG - Intronic
944315860 2:198285233-198285255 CATTCTAGGAAGAAGTCTGCAGG - Intronic
944496320 2:200310552-200310574 CAATCCTTGAAGAGTTTTGAGGG - Intronic
945111976 2:206368595-206368617 CATTTTAACAAGAATTTTCAAGG + Intergenic
945286107 2:208083781-208083803 AGTTCTATGAAGAATGATGATGG - Intergenic
945325333 2:208475534-208475556 GATTCTATGAATTATTTTTATGG - Intronic
945480818 2:210343450-210343472 AATTCTGTGAAGAATGATGATGG + Intergenic
945826188 2:214722817-214722839 AATTCTGTGAAGAATGATGATGG - Intergenic
945838695 2:214862757-214862779 AGTTCTATGAAGAATGATGATGG + Intergenic
946785830 2:223243033-223243055 AATTCTATGAAGAATATCAATGG + Intergenic
1168733978 20:114517-114539 GATTCTATGACCAATTTTGAGGG + Intergenic
1169780360 20:9302676-9302698 CACTATATGAAGAACTTTGGAGG - Intronic
1170011863 20:11732653-11732675 AATTCTATGAAGAATGTCAATGG - Intergenic
1170416744 20:16151587-16151609 CATTAGATGAAGTATTTTGTAGG - Intergenic
1170492539 20:16893223-16893245 AATTCTATGAAGAATGTCAATGG - Intergenic
1171080217 20:22174024-22174046 TGTTCTATGAAGAATGATGATGG + Intergenic
1171137954 20:22714393-22714415 AATTCTGTGAAGAATGTTAATGG + Intergenic
1171172459 20:23027555-23027577 CATTGGATAAAGCATTTTGAGGG - Intergenic
1171241927 20:23577048-23577070 AGTTCTATGAAGAATGATGATGG + Intergenic
1171937687 20:31291243-31291265 AATTCTATGAAGAATGTCAATGG - Intergenic
1173220333 20:41127112-41127134 CATTATTTGAAGAATTTCTAAGG - Intergenic
1173238744 20:41273975-41273997 CATTCTATGATGTAATTTTAAGG + Intronic
1173673504 20:44814105-44814127 CATTCTAAGAACAAGTTTGGGGG + Intergenic
1174148184 20:48467208-48467230 CATTCTATGAAGAGCATGGAGGG + Intergenic
1174312425 20:49668421-49668443 CATGCTATTAAGAATTTTGGGGG - Intronic
1176987220 21:15451368-15451390 AATTCTGTGAAAAATGTTGATGG + Intergenic
1177007987 21:15697623-15697645 CATTCTGTGAAGAAAGTTAATGG - Intergenic
1177664219 21:24132331-24132353 CATTCTATTAATAAATTTCATGG - Intergenic
1177923366 21:27182810-27182832 CATGCTAAGAGGAATTGTGATGG - Intergenic
1178033930 21:28559583-28559605 AATTCTATGAAAAATGTTGATGG - Intergenic
1178161511 21:29921910-29921932 CAATCTAAGAATAATTTTGCAGG + Intronic
1179019269 21:37623427-37623449 CATTCAATGAATATTTATGATGG + Exonic
1180536975 22:16402420-16402442 AATTCTCTGAAGAATGATGATGG - Intergenic
1180859186 22:19067389-19067411 CATTTTAAGAAAAATTTTTAAGG - Intronic
1181185881 22:21103337-21103359 CATTCTCTGAAGGCTTTTGAGGG + Intergenic
1181717460 22:24742361-24742383 AGTTCTATGAAGAATGATGATGG - Intronic
1182637155 22:31737173-31737195 CATTCCTTTAAGAATTTGGAGGG + Intronic
1182952228 22:34387883-34387905 AATTCTGTGAAGAAAGTTGATGG + Intergenic
949128985 3:478657-478679 AATTCTGTGAAGAATGTTAAAGG - Intergenic
949277651 3:2304414-2304436 CATTCTATGAAACATATTTAGGG + Intronic
949962777 3:9327722-9327744 CATTTTATGAAGCATTTAGGAGG + Intronic
950561557 3:13731919-13731941 AATTCTGTGAAGAAAGTTGACGG + Intergenic
951039865 3:17978155-17978177 CATCCTATTAATAATTTTGAGGG + Intronic
951124893 3:18971815-18971837 CTTTCTATGAAGAATGTTATTGG + Intergenic
951313251 3:21156700-21156722 AAGACTTTGAAGAATTTTGAGGG + Intergenic
951599139 3:24353968-24353990 GCTTCTATTAAGAATTTTAAAGG + Intronic
952624611 3:35389740-35389762 CATTGTCTGAAAAATTTTAAAGG - Intergenic
953382579 3:42484889-42484911 AGTTCTATGAAGAATAATGATGG - Intergenic
956157498 3:66313645-66313667 GATTCTGTGAAGAATGTTAATGG + Intronic
956174424 3:66459562-66459584 TTTTGTATGAAGAATTTTGGAGG - Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956733280 3:72216343-72216365 CATTCTGTCAAGCATTGTGAAGG + Intergenic
957535913 3:81503329-81503351 CCATATATGAAGACTTTTGAAGG + Intronic
957685131 3:83494236-83494258 AATTCTGTGAAGAATTGTGGTGG - Intergenic
957724679 3:84048467-84048489 CATTTTATGAAGCATTTAGGAGG - Intergenic
957845667 3:85731169-85731191 CATCATATGAAAAATTTTGGAGG + Intronic
957972045 3:87394811-87394833 AATTCTCTGAAGAATGATGATGG - Intergenic
958458761 3:94367223-94367245 AATTCTGTGAAGAATTTCAATGG + Intergenic
958597403 3:96245240-96245262 CATTCCATGAAGAAGGTTGTTGG + Intergenic
958770190 3:98416651-98416673 CCATCAATGCAGAATTTTGAGGG + Intergenic
959039431 3:101404035-101404057 AATTCTATGAAGAATGTTGTTGG - Intronic
959205420 3:103300710-103300732 AATTCTATGAAGAATGTCAATGG + Intergenic
959274951 3:104266805-104266827 AATTCTATGAAGAATGATGGTGG + Intergenic
959360123 3:105378434-105378456 CTTTCTAAGAAGAATGTTTATGG + Intronic
959390897 3:105771990-105772012 AGTTCTGTGAAGAATGTTGATGG - Intronic
959463610 3:106657423-106657445 AGTTCTGTGAAGAATTATGATGG - Intergenic
959757753 3:109919329-109919351 CATACTACGAAGAGTTTGGAAGG - Intergenic
959760825 3:109962538-109962560 CATTCTATGAAAAATTTTGAAGG - Intergenic
959765629 3:110023974-110023996 AATTCTGTGAAGAATGATGATGG - Intergenic
959917959 3:111839258-111839280 CATTCTATAAAGAATATTATTGG + Intronic
960455910 3:117871752-117871774 AATTTTATTAGGAATTTTGAAGG - Intergenic
962245898 3:133792398-133792420 CATTTTATGAAGCATTTAGGAGG - Intronic
962401481 3:135063211-135063233 AATTCTGTGAAGAATGTTGGAGG + Intronic
962504467 3:136032029-136032051 AATTCTGTGAAAAATGTTGATGG + Intronic
962673286 3:137731421-137731443 AGTTCTGTGAAGAATTATGATGG + Intergenic
963025542 3:140915227-140915249 TATTTTAAGTAGAATTTTGAAGG + Intergenic
963383926 3:144567112-144567134 ACTTCTATGAAGAATGATGATGG - Intergenic
963402405 3:144816591-144816613 CATTGAATGCAGAATTTAGAGGG + Intergenic
963526494 3:146421671-146421693 CATTCCATTCAGAATTTTGAAGG + Intronic
963534789 3:146514056-146514078 CATTGCATGAAGAATATTGTGGG + Intergenic
964007361 3:151847795-151847817 AATTCTGTGAAGAATGTTAAGGG + Intergenic
964144116 3:153438052-153438074 AATTCTTTGAATGATTTTGAAGG - Intergenic
964294751 3:155221145-155221167 AATTCTGTGAAGAATGTTAATGG + Intergenic
964505773 3:157397455-157397477 AATTCTGTGAAGAATGTTAATGG + Intronic
964571751 3:158114525-158114547 GATTCTGTGAAGAATGTTAATGG + Intronic
964578635 3:158204874-158204896 CATTATATGGGGAATTTTAAAGG + Intronic
964607939 3:158578062-158578084 CATTCAAAGAAGGATCTTGAGGG - Intronic
964681635 3:159346308-159346330 CATTCAATGAAAGATTTGGAAGG + Intronic
965042349 3:163526124-163526146 CATTATTTGAAGAATTATGATGG - Intergenic
965295218 3:166936767-166936789 AATTCTATGAAGAATGTTGGTGG + Intergenic
965345513 3:167544280-167544302 AATTCTGTGAAGAATGATGATGG - Intronic
965501260 3:169458722-169458744 CATCCTGTGAAAAATTTAGATGG - Intronic
966133985 3:176677433-176677455 AATTCTGTGAAGAATTTCAATGG - Intergenic
966344147 3:178959837-178959859 AATTCTGTGAAGAATGATGATGG + Intergenic
966467181 3:180243150-180243172 AATTCTGTGAAGAATTATGGTGG + Intergenic
966598684 3:181752437-181752459 GTTTCTAGGAAGAATTATGATGG + Intergenic
967060410 3:185867345-185867367 GAATCATTGAAGAATTTTGAGGG - Intergenic
967567593 3:190990053-190990075 AATTCCATGAAGAATGTTGTTGG + Intergenic
967767449 3:193296712-193296734 AATTCTGTGAAGAATATTAATGG + Intronic
967790383 3:193542438-193542460 AATTCTATGAAGAATGTCAATGG - Intronic
969137976 4:5045979-5046001 AATTCTGTGAAGAATGTTAATGG - Intergenic
969419881 4:7087300-7087322 CATTTTATGAAGCATTTAGAAGG + Intergenic
969742175 4:9037231-9037253 AATTCTATAAAGAATGATGATGG - Intergenic
970034449 4:11716605-11716627 AATTCTATGATGATTTGTGATGG + Intergenic
970297538 4:14646766-14646788 CAATCTGTGAAGTATTTTTAGGG - Intergenic
970454335 4:16207160-16207182 CATTATGAGAAGAATTTAGAGGG + Intronic
971270212 4:25136679-25136701 AATTCTATGAAGAATGTCAACGG - Intronic
971471916 4:27035810-27035832 AGTTCTATGAAGAATGATGATGG + Intergenic
971517056 4:27500419-27500441 AATTCTATGAAGAATGTCAATGG - Intergenic
971565744 4:28138602-28138624 CATTTGAAGAAGAATTTTGCTGG + Intergenic
971641893 4:29144898-29144920 AATTTTATGATCAATTTTGAAGG - Intergenic
971708161 4:30075568-30075590 CATTCTATAAAGAATGTTTTTGG + Intergenic
971853461 4:32013360-32013382 AATTCTGTGAAGAATGTTAATGG - Intergenic
972190977 4:36590197-36590219 AATTCTATGAAGAATGTCAATGG + Intergenic
972727048 4:41753963-41753985 CATTCTTTTAAGAACTTTTAAGG + Intergenic
973179215 4:47247545-47247567 AATTCTATGAAGAATGATGGTGG + Intronic
974327743 4:60436999-60437021 CATTCTGTGAAGAATGATGGTGG - Intergenic
974597634 4:64035895-64035917 AATTCTGTGAAGAATGTTGATGG - Intergenic
975099750 4:70499290-70499312 CGTTCTGTGAAGAATGATGATGG - Intergenic
975290574 4:72673385-72673407 AATTCTATGAAAAATGTTGTTGG + Intergenic
975417682 4:74124157-74124179 CCTGCTTTGAAGAGTTTTGATGG + Intronic
975842373 4:78488542-78488564 AATTGTAAGAAAAATTTTGATGG - Intronic
976089626 4:81442982-81443004 TATTCTTTTAAGAATGTTGAGGG - Intronic
976363570 4:84208212-84208234 AATTCTGTGAAGAAAGTTGATGG - Intergenic
976464364 4:85350933-85350955 CATTCTGTGAAGAATGATGGTGG + Intergenic
976665924 4:87591733-87591755 CTTTCTGTGAAGAATCTTGCCGG - Intergenic
976888260 4:90012307-90012329 AGTTCTATGAAGAATTATGGAGG - Intergenic
977095888 4:92743572-92743594 CATTTTATGTAAAATTTTGGGGG + Intronic
977402264 4:96547482-96547504 CAATCTAGAAAGAATTCTGAAGG - Intergenic
977404913 4:96584989-96585011 CATTCTCTGAAGACTTTTATAGG - Intergenic
977502621 4:97860252-97860274 AGTTCTATGAAGAATCATGATGG + Intronic
977521543 4:98090581-98090603 AATTCTGTGAAGAATGATGATGG + Intronic
977747141 4:100562866-100562888 AATTCCATGAAGAATGGTGATGG - Intronic
978480850 4:109188781-109188803 CATTCTATGGAGGATTTCCATGG - Intronic
978726296 4:111973441-111973463 AATTCTGTGAAGAATTATGGTGG + Intergenic
979338019 4:119486158-119486180 AATTCTGTGAAGAATGTCGATGG - Intergenic
979574894 4:122278417-122278439 AATTCTGTTAAGAGTTTTGATGG - Intronic
979712848 4:123801247-123801269 CGTTCTATTAATAATTTTTAAGG - Intergenic
979940279 4:126753511-126753533 CAGTCTTTGAATAATCTTGATGG + Intergenic
980021717 4:127718509-127718531 AATTCTATGAAGAATATCAATGG + Exonic
980507895 4:133746603-133746625 CATTCTGTGAAGAATGTCAATGG - Intergenic
980573664 4:134657779-134657801 CATTCTGTGAAGAATGTCAATGG + Intergenic
980694973 4:136342661-136342683 AATTCTGTGAAGAATGTTGTTGG - Intergenic
980888740 4:138791485-138791507 CATTTTATGGGGAAATTTGATGG - Intergenic
981266461 4:142789703-142789725 AATTCTGTGAAGAATGTTGATGG - Intronic
981415968 4:144493895-144493917 CATGGTATGAACAATTTTCATGG + Intergenic
981721422 4:147805495-147805517 AATTCTATGAAGAATGTCAATGG + Intronic
982804101 4:159741707-159741729 AGTTCTGTGAAGTATTTTGATGG + Intergenic
982908806 4:161113680-161113702 AATTCTATGAAGAAAGTTAATGG + Intergenic
983033283 4:162830261-162830283 CATGTTATGGAGAATTTTGAAGG - Intergenic
983103600 4:163657525-163657547 AATTCTGTGAAGAATTTCCATGG - Intronic
983169238 4:164517122-164517144 TATTCTATGAAGAATGTAAATGG + Intergenic
983330763 4:166325195-166325217 CTTTCGATGAAAAATTTTCATGG - Intergenic
983402701 4:167285487-167285509 AATTCTATGAAGAATGTGAATGG + Intergenic
983685439 4:170402813-170402835 AATTCTATGAAGAATGATGGTGG + Intergenic
983687365 4:170427555-170427577 CATTTTATAAAGAATTTTAATGG + Intergenic
983716739 4:170790739-170790761 CAATCTATGAAGAAGTCTCAAGG + Intergenic
984531323 4:180920080-180920102 CATTCTATGAGTACATTTGAAGG + Intergenic
985018043 4:185657799-185657821 CATTTTATGAAGAAGGCTGAGGG + Intronic
985046060 4:185941486-185941508 CATTCGTTCAAGATTTTTGAGGG - Intronic
985547149 5:515410-515432 CAGTCTAGGAAGAATTGAGATGG - Intronic
985832727 5:2247167-2247189 CATTCTCTCAAGAATTTTTTTGG + Intergenic
986088185 5:4474493-4474515 TTTTCTATCAAAAATTTTGAGGG + Intergenic
986956096 5:13151707-13151729 AATTCTATGAAGAATGTCAATGG + Intergenic
987006185 5:13711979-13712001 CATTCTTTGAAGAATGATGGTGG - Intronic
987021086 5:13872165-13872187 CAGTCAATGAAGAATCTTGGAGG - Intronic
987633872 5:20512985-20513007 CATGCTACGGTGAATTTTGAAGG - Intronic
987704091 5:21441696-21441718 AATTCTGTGAAGAATGCTGATGG + Intergenic
987753531 5:22070727-22070749 CATTCTGTGAAGAATGTCAATGG + Intronic
987806266 5:22773119-22773141 AATTCTATGAAGAATTATATTGG - Intronic
987836978 5:23174531-23174553 AATTCTGTGAAGAATGTTAATGG + Intergenic
987909735 5:24125823-24125845 AATTCTATGAAGAATGTCAATGG + Intronic
987988118 5:25176615-25176637 AATTCTATGAAGAATGTCAATGG + Intergenic
988089706 5:26521222-26521244 ATTTCTATCAAGAATTGTGAAGG + Intergenic
989336949 5:40329140-40329162 CATTTTATGAAGCATTTGGGAGG + Intergenic
990239999 5:53807377-53807399 AATTCTATGAAGAAAGTTGTTGG - Intergenic
990573329 5:57101020-57101042 AATTCTGTGAAGAATGATGATGG - Intergenic
991162800 5:63524771-63524793 CATTCTATAAATATTTTTCAAGG - Intergenic
992607051 5:78468584-78468606 CAGTCTATGAACAAATTTCATGG - Intronic
993851552 5:93016260-93016282 CCTTCTCTGAAGACTCTTGATGG - Intergenic
994050942 5:95361534-95361556 AGTTCTGTGAAGAATTTTGGTGG + Intergenic
994277137 5:97852941-97852963 AGTTCTATGAAGAATGCTGATGG - Intergenic
994299190 5:98125996-98126018 AATTCTGTGAAGAATTTCAATGG - Intergenic
994665173 5:102696555-102696577 CTTTCTCTGAGGAATTTAGAAGG + Intergenic
994883358 5:105526963-105526985 AATTCTATGAAGAATGATGGTGG + Intergenic
994917634 5:106000583-106000605 AATTCTGTGAAGAAATTAGATGG + Intergenic
994964332 5:106648630-106648652 CATTCTTTGAAAACTTTTGAAGG - Intergenic
996000263 5:118353220-118353242 CATTCAATCAAGAGTTTTGGGGG + Intergenic
996229603 5:121045465-121045487 CATTCAATACAGAATTATGATGG + Intergenic
996481817 5:123984248-123984270 AATTCTGTGAAGAATGTTAATGG + Intergenic
996650291 5:125867661-125867683 AATTCTTTAAAGAATTTTTAGGG - Intergenic
997338432 5:133123865-133123887 TTTTCTCTGAAGAATGTTGAGGG + Intergenic
997797981 5:136830012-136830034 CATTCTGTGAAGAATGATGGTGG + Intergenic
997881932 5:137599512-137599534 TATTTGATGAAGAAATTTGATGG + Intergenic
997899432 5:137751950-137751972 AATTCTGCAAAGAATTTTGATGG + Exonic
998434892 5:142099487-142099509 AATTCTATGAAGAACTATTATGG + Intergenic
998889618 5:146732029-146732051 CCTTCTGTGGAGATTTTTGATGG + Intronic
998991166 5:147818811-147818833 CATTCTTTTAAGTATTTTAAAGG + Intergenic
999086475 5:148896046-148896068 AGTTCTGTGAAGAATTATGATGG - Intergenic
999431182 5:151526812-151526834 GATTCTATGAGTAATTTTCAGGG - Intronic
999834797 5:155358014-155358036 AATTCTGTGAAAAATGTTGATGG - Intergenic
1000264898 5:159626376-159626398 AATTCTGTGAAGAATGATGATGG - Intergenic
1000376500 5:160587457-160587479 AATTCTGTGAATAATGTTGATGG + Intronic
1000494089 5:161956536-161956558 AATTCTTTGAAGAATTGTAATGG + Intergenic
1000615939 5:163426754-163426776 AATTCTGTGAAGAATTATGGTGG - Intergenic
1000625909 5:163538028-163538050 AATTCTATGAAGAATGTCAATGG + Intergenic
1000673343 5:164089752-164089774 AATTCTGTGAAGAAATTTAATGG + Intergenic
1000757451 5:165179341-165179363 AATTCTATGAAGAATGTTGGTGG + Intergenic
1002156111 5:177281373-177281395 CATTTTCTGAAGAATTTTATTGG + Intronic
1002157187 5:177292256-177292278 CTTTCCATGCATAATTTTGAGGG + Intronic
1002806488 6:580634-580656 AATTTTATGAAGAATTTCCATGG + Intronic
1003034415 6:2630660-2630682 TAATGAATGAAGAATTTTGATGG - Intronic
1003902204 6:10665074-10665096 AATTCTATGAAGAATGTCAATGG + Intergenic
1004949347 6:20651079-20651101 AATTCTATGAAGAATGTCAATGG + Intronic
1005151967 6:22761844-22761866 AATTCTGTGAAGAATGTTAATGG + Intergenic
1005194266 6:23264831-23264853 CCTTATATGAAGAATTTAGAAGG + Intergenic
1006819516 6:36880968-36880990 CATTTTATGAAGCATTTAGGAGG - Intronic
1006999217 6:38293284-38293306 AATTCTATGAAGAAATTCAATGG - Intronic
1008260002 6:49354180-49354202 AATTCTATAAAGAATGTTGTTGG - Intergenic
1008401996 6:51074121-51074143 TGTTCTATGAAGAATGTTGGTGG + Intergenic
1008462775 6:51795051-51795073 AATTCTGTGAAGAATCTTAATGG + Intronic
1008801860 6:55378244-55378266 CATTCTATGAAGAATTTTGATGG + Intronic
1009541410 6:64964301-64964323 TATTGTATGAAAACTTTTGAAGG - Intronic
1009725081 6:67528766-67528788 GATTCTATGAAGAATTTCAATGG - Intergenic
1009779549 6:68252430-68252452 AGTTCTATGAAGAATGATGATGG + Intergenic
1009832240 6:68953078-68953100 ATTTCTATGAAGAATTAGGAAGG - Intronic
1010101846 6:72119418-72119440 AATTCTGTGAAGAATGATGATGG - Intronic
1010315924 6:74450363-74450385 AGTTCTGTGAAGAATTATGATGG + Intergenic
1010738086 6:79465516-79465538 CATTCTGTGAAGAGTTTAAAAGG + Intergenic
1010740478 6:79497014-79497036 CATTTCATGAAGAATATGGATGG - Intronic
1011816030 6:91191940-91191962 TATTCTTTGACAAATTTTGATGG - Intergenic
1012232232 6:96773486-96773508 AATTCTATGAAGAATGTCAATGG - Intergenic
1012343085 6:98152986-98153008 AATTCTGTGAAGAATTTCAATGG + Intergenic
1012794183 6:103738854-103738876 AATTCTATGAAGAATGATGGTGG - Intergenic
1012801601 6:103836525-103836547 CATTTAATGAAGGATTTTAAGGG - Intergenic
1013142976 6:107358539-107358561 CATTCTATGGAGAATAAAGATGG + Intronic
1013687719 6:112604459-112604481 AATTCTATGAAGAATTTCATTGG - Intergenic
1013958259 6:115866330-115866352 CATTCCCTAAAGAATTTTAAAGG + Intergenic
1014085212 6:117334461-117334483 AATTCTATGAAGAATGTCAACGG - Intronic
1014279256 6:119422553-119422575 AATTCTATGAAGAAGGTTAATGG - Intergenic
1014304472 6:119723333-119723355 AATTCTGTGAAGAATTATGGTGG + Intergenic
1014327993 6:120023700-120023722 AATTCTATGAAGAATGTCAATGG + Intergenic
1014481690 6:121946828-121946850 AGTTCTGTGAAGAATGTTGATGG + Intergenic
1014601291 6:123416563-123416585 CTTGCTATGAAGAATTGAGAGGG - Intronic
1015017131 6:128427204-128427226 CTTTCTTTAAAGAATTGTGAGGG - Intronic
1015222520 6:130820878-130820900 AATTCTATGAAGAATGATGGTGG - Intergenic
1015902295 6:138080554-138080576 AATTCTGTGAAGAATGTTAATGG - Intergenic
1015992212 6:138957509-138957531 CATTCTTGGAAAAATATTGAAGG + Intronic
1016586487 6:145692938-145692960 AATTCTGTGAAGAATTTTATTGG + Intronic
1017200015 6:151742809-151742831 CATTCAATCAATATTTTTGAGGG + Intronic
1017573516 6:155774704-155774726 AATTCTATGAAGAATGTCAATGG + Intergenic
1017978448 6:159377611-159377633 CATTCAATGAATAATTTTGCTGG + Intergenic
1018033062 6:159859002-159859024 CAGTCTATGAAGGAATTTAAAGG + Intergenic
1020365325 7:7374491-7374513 CATGCTATGAAAGCTTTTGAGGG + Intronic
1020374819 7:7472639-7472661 AATTCTGTGAAGAATGATGATGG - Intronic
1020466702 7:8487907-8487929 CCTTATCTGAAGAATTTTAAGGG + Intronic
1020871635 7:13637841-13637863 TATTCTATAAAGAACTTTGAAGG + Intergenic
1023529077 7:41134929-41134951 CATCCTATGTAAAATTTTGAGGG + Intergenic
1024752845 7:52488831-52488853 CATTCTCTGTAGAAATTTAAGGG + Intergenic
1024907534 7:54404765-54404787 AATTCTGTGAAGAATTTAAACGG + Intergenic
1025234281 7:57223372-57223394 CATTCTATGAAGAGCATGGAGGG - Intergenic
1025767980 7:64475666-64475688 TATTCTATGTAAAATTTTTAGGG + Intergenic
1025768977 7:64485748-64485770 CATTTTATGAAGCATTTAGGAGG - Intergenic
1025862655 7:65346182-65346204 AATTCTGTGAAGAATGTTAATGG + Intergenic
1027960934 7:84944065-84944087 CATTTTATGAAGCATTTAGGAGG - Intergenic
1028009059 7:85617190-85617212 AATTCTATGAAGAATCTCAATGG - Intergenic
1028028583 7:85879017-85879039 AGTTCTATGAAGAATGATGATGG - Intergenic
1028098912 7:86796585-86796607 AATTCTGTGAAGAATGTCGATGG + Intronic
1028182655 7:87744336-87744358 AATTCTATGAAGAATGGTGGTGG + Intronic
1028300705 7:89196019-89196041 AATTCTGTGAAGAATGTCGATGG - Intronic
1028490221 7:91403083-91403105 AGTTCTATGAAGAATGTTGATGG + Intergenic
1028715402 7:93960730-93960752 GAATCTATGAATAATTTTGGGGG - Intergenic
1028848836 7:95513491-95513513 CGTTCTATGAAGACTTTCAATGG + Intronic
1029804936 7:102986265-102986287 CAATCTATGAAAAATGTTGCTGG + Intronic
1030144253 7:106337016-106337038 CATTTTATGAAGCATTTAGGAGG - Intergenic
1030413397 7:109211001-109211023 TATTCTGTGAAGAATGTTAATGG + Intergenic
1030610770 7:111686663-111686685 ATTTCTATGCAGAATATTGAAGG + Intergenic
1030732603 7:113007680-113007702 AATTCTGTGAAGAATATCGATGG + Intergenic
1031305232 7:120117642-120117664 CATTTTATGAAGCATTTAGGAGG - Intergenic
1031654567 7:124337815-124337837 CATTCTTTTAAGAATTTTGGTGG + Intergenic
1031663982 7:124462241-124462263 AGTTCTATGAAGAATGTTGTTGG + Intergenic
1031683595 7:124705094-124705116 AATTTTATGAAGAATTGTAATGG + Intergenic
1031746217 7:125501391-125501413 ATTTCTGTGAAGAATTTTGTTGG + Intergenic
1031894911 7:127337732-127337754 CAGTCTATGAAGAACTTTCCTGG + Intergenic
1032671703 7:134089589-134089611 TATTCTATGAAGCATTTAGGAGG + Intergenic
1032831365 7:135630250-135630272 CATTTTATAAATAATGTTGAAGG - Intronic
1032914099 7:136467928-136467950 AATTCTGTGAAGAATGTTAATGG + Intergenic
1033373802 7:140737290-140737312 CATTCTATGTAAAATTTTAAAGG - Intronic
1034019954 7:147631446-147631468 AGTTCTGTGAAGAATATTGATGG - Intronic
1034682821 7:152942825-152942847 AATTCTATGAAGAATAATGGAGG + Intergenic
1034857538 7:154566032-154566054 TGTACTATGAAGAAATTTGAAGG + Intronic
1034903047 7:154919699-154919721 CTTTCTCTGAATAATTTTCAAGG - Intergenic
1037087276 8:14867944-14867966 CATACTGTGAAAAATTTTGTGGG + Intronic
1038845204 8:31222613-31222635 CATTTTATGAAGAAATTGGGGGG + Intergenic
1039632379 8:39126195-39126217 AATTCTATGAAGAATGTCAATGG + Intronic
1041112385 8:54496082-54496104 AATTCTGTGAAGAATGTTGGTGG + Intergenic
1041323562 8:56639534-56639556 CATTCTCTCAAGGGTTTTGAAGG - Intergenic
1041388892 8:57331730-57331752 CATGGCATGAAGCATTTTGATGG + Intergenic
1041417546 8:57628489-57628511 CATGCTATAGAGAATTATGAGGG - Intergenic
1042392091 8:68247752-68247774 CATTCTGTGAAAAATGATGATGG + Intergenic
1043089340 8:75877543-75877565 AATTCTGTGAAGAATGTTAATGG + Intergenic
1043754942 8:83991464-83991486 ATTTCTATGAAGAATGTTGTTGG - Intergenic
1043792811 8:84494428-84494450 AATTCTGTGAAGAATGTTCATGG + Intronic
1044312767 8:90713060-90713082 CATCTTCTGAAGAAGTTTGATGG - Intronic
1044876921 8:96678196-96678218 AATTCTGTGAAGAATGATGATGG + Intronic
1044929361 8:97237099-97237121 CAGACTTTGAAGAATTCTGAAGG - Intergenic
1045760122 8:105595492-105595514 GATTTTAAGAAGAGTTTTGAAGG + Intronic
1046865182 8:119141079-119141101 AATTCTGTGAAGAATGTTAATGG + Intergenic
1047226967 8:122963648-122963670 AGTTCTATGAAGAATGATGATGG + Intronic
1047899132 8:129400735-129400757 AATTCTGTGAAGAATTTCAATGG - Intergenic
1048173150 8:132127752-132127774 TATTCTCTGAAAAACTTTGATGG - Exonic
1050015630 9:1230469-1230491 AAATCTATGAATAAATTTGAAGG - Intergenic
1050239115 9:3615553-3615575 AATTCTGTGAAGAATTTCAATGG + Intergenic
1050675464 9:8047751-8047773 AATTCTGTGAAGAATGATGATGG - Intergenic
1050986976 9:12094721-12094743 ATTTCTATGAAGAATATGGAAGG - Intergenic
1051012300 9:12432128-12432150 AATTCTATGAAAAATTATGTTGG + Intergenic
1052078793 9:24177848-24177870 AGTTCTGTGAAGAATCTTGATGG + Intergenic
1052421253 9:28245908-28245930 AATTCTGTGAAGAATGTTAATGG - Intronic
1052521345 9:29551527-29551549 CATTTTATGAAGCATTTAGGAGG - Intergenic
1053490167 9:38493669-38493691 AATCCTATGAAGAATTTTAATGG - Intergenic
1053584789 9:39445557-39445579 AATTCTCTGATGTATTTTGAGGG + Intergenic
1054581528 9:66919665-66919687 AATTCTCTGATGTATTTTGAGGG - Exonic
1054840387 9:69732052-69732074 CATTCTCAGAAGAGCTTTGAAGG - Intronic
1055342932 9:75304508-75304530 AATTCTGTGAAGAATTTCAATGG + Intergenic
1055420099 9:76130799-76130821 AATTCCAGGAAGAAATTTGAGGG + Intronic
1055543945 9:77347210-77347232 AGTTCTGTGAAGAATGTTGATGG + Intronic
1056414191 9:86360583-86360605 CCTTCTATGCAAAATTTTGCCGG + Intergenic
1056616273 9:88169040-88169062 CATTTTATTAAGAAGTTTTAAGG - Intergenic
1056885502 9:90439638-90439660 AATTCTGTGAAGAATGTTGATGG + Intergenic
1057670494 9:97082960-97082982 AATTCTATGAAGAATTTCAATGG - Intergenic
1057725969 9:97568405-97568427 CATTCTATGAGGATTTGAGAGGG + Intronic
1057962679 9:99471524-99471546 CATTCTTTGAAGATTATTGTAGG + Intergenic
1058303191 9:103402100-103402122 TTTTCTATGAAGAATGTTGTTGG + Intergenic
1059031732 9:110705307-110705329 TATTGGCTGAAGAATTTTGAAGG + Intronic
1059347596 9:113640283-113640305 AATTCCATAAAGAATTTTCAGGG + Intergenic
1059900999 9:118925291-118925313 CATGCTAGGAAGAATTCTGAGGG + Intergenic
1060456968 9:123807724-123807746 CATTCCATGAAGTCTGTTGAAGG - Intronic
1185987917 X:4856573-4856595 CAATATATGAAGAAATTTGAGGG + Intergenic
1186379502 X:9043066-9043088 AATTCTATGAAGAATGTCAATGG - Intronic
1186713378 X:12224511-12224533 CACATTATGAAGAATTTAGAGGG + Intronic
1186930239 X:14381321-14381343 AATTCTAACAAGAATTTTGGAGG - Intergenic
1186966142 X:14788176-14788198 CACTATATGAAGTATTTTAATGG + Intergenic
1187108863 X:16274789-16274811 AATTCTTTGAAGAATGATGATGG + Intergenic
1188257212 X:27977594-27977616 CATTCTTTGCAGAATTTTCTTGG - Intergenic
1188516850 X:30997020-30997042 CATTTTATGAATGCTTTTGACGG + Intergenic
1188838027 X:34982756-34982778 CATTCTGTGAAGAATGTTATGGG - Intergenic
1189651938 X:43199327-43199349 AATTCTGTGAAGAATGTTGATGG + Intergenic
1191005738 X:55709860-55709882 CATTTTATGAAGTATTTAGGAGG + Intergenic
1191120852 X:56902927-56902949 CATTTTATGAAAAATTTAGGAGG - Intergenic
1191209443 X:57869909-57869931 AAGTCTGTGAAGAATATTGATGG + Intergenic
1191626262 X:63274543-63274565 CATTTTATGAAGAAATTCAAGGG + Intergenic
1191722400 X:64244253-64244275 AATTCTGTGAAGAATTTCGTTGG + Intergenic
1193024725 X:76833737-76833759 AGTTCTGTGAAGAATTTTAATGG + Intergenic
1193119654 X:77809952-77809974 AATTCTGTGAAGAATGATGATGG + Intergenic
1193296386 X:79837078-79837100 CATTCTATTACCAGTTTTGAGGG + Intergenic
1193363871 X:80607770-80607792 CATTTTATGAAGCATTTAGGAGG - Intergenic
1193383010 X:80838566-80838588 AGTACTATGAAGAATTATGATGG - Intergenic
1193589295 X:83367612-83367634 CATTCTATGAAGAATGTCAATGG + Intergenic
1193960655 X:87921288-87921310 GATTCTTTGAAGATTTTTGAGGG + Intergenic
1193964256 X:87965203-87965225 AATTCTGTGAAAAATTATGATGG - Intergenic
1194191672 X:90844299-90844321 AATTCTGTGAAGAATGATGATGG + Intergenic
1194221159 X:91193181-91193203 AATTCTATGAAGAATGTCAATGG - Intergenic
1194420663 X:93669437-93669459 CATCCTATGTAGAAGTTTTAAGG + Intergenic
1194436950 X:93878302-93878324 CATTCTGTGAAGAATGTTAATGG - Intergenic
1194520396 X:94911073-94911095 AATTCTATGAAGAATGTTATTGG - Intergenic
1194543102 X:95199318-95199340 AATTCTGTGAAGAATTATGGTGG + Intergenic
1194587818 X:95758255-95758277 AATTCTATGAAGAATGATGATGG + Intergenic
1194606251 X:95982346-95982368 AATTCTGTGAAGAATGATGATGG + Intergenic
1194706449 X:97181030-97181052 AATTCTATGAAGAATGTCAATGG + Intronic
1194911091 X:99645442-99645464 AATTCTGTGAAGAATATTAATGG + Intergenic
1195013907 X:100759565-100759587 GGTTCTATGAAGAATGATGATGG - Intergenic
1195131016 X:101852256-101852278 AATACTATGAACAATTTTGCAGG + Intronic
1195287990 X:103404109-103404131 CTTACTACCAAGAATTTTGAAGG + Intergenic
1195556868 X:106236710-106236732 AATTCTGTGAAGAATGATGATGG - Intergenic
1196202392 X:112900227-112900249 CATCCGAAGAAGAATATTGAAGG - Intergenic
1196203538 X:112913011-112913033 CATCCGAAGAAGAATATTGAAGG - Intergenic
1196400885 X:115314924-115314946 CATTTTATGAAGCATTTAGGAGG + Intergenic
1196537509 X:116864822-116864844 AATTCTATGAAGAATGTCAATGG + Intergenic
1197007688 X:121522473-121522495 AATTCTATGAAGAATGTCAATGG - Intergenic
1197130406 X:122999077-122999099 AGTTCTTTGAAGAATTATGATGG + Intergenic
1197456058 X:126676712-126676734 AATTCTGTGAAGAATGTTAATGG - Intergenic
1197560019 X:128008910-128008932 CATTCTGTGAATAATTTTATTGG + Intergenic
1197609030 X:128617585-128617607 ATTTCTATGAAGAATGTTGAAGG - Intergenic
1197922763 X:131612854-131612876 CATTCTATGAAGAATTCAATGGG + Intergenic
1198562096 X:137861428-137861450 CATTCTATGAGGAAGGATGAAGG + Intergenic
1198844693 X:140898376-140898398 CATTTTATGAAGCATTTAGGAGG + Intergenic
1198914756 X:141657054-141657076 AATTCTATGAAAAATATTGTTGG - Intronic
1199098966 X:143775821-143775843 AATTCTATGAAGAATGATGCTGG + Intergenic
1199283721 X:146033180-146033202 AGTTCTATGAAGAATGATGATGG - Intergenic
1199360493 X:146912157-146912179 TATCCTAAGAAGAATTTTGCTGG + Intergenic
1199588923 X:149447650-149447672 AATTCTATGAAGAATATCAATGG + Intergenic
1199918893 X:152375097-152375119 GATTCTGTGAAGAATGTCGATGG - Intronic
1200299499 X:154958446-154958468 TTTTCCATGGAGAATTTTGAAGG - Intronic
1201226721 Y:11825678-11825700 CATTCCAAGAAGCATTTTGTGGG + Intergenic
1201669532 Y:16502686-16502708 AATTCTATGAATAATGTTAATGG + Intergenic