ID: 1008806213

View in Genome Browser
Species Human (GRCh38)
Location 6:55431771-55431793
Sequence AGGTTTTTACTCATGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008806213_1008806219 6 Left 1008806213 6:55431771-55431793 CCTTCCACCATGAGTAAAAACCT No data
Right 1008806219 6:55431800-55431822 GCCCTCCCAGAAGCAGATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008806213 Original CRISPR AGGTTTTTACTCATGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr