ID: 1008808246

View in Genome Browser
Species Human (GRCh38)
Location 6:55457915-55457937
Sequence CTTTGTAAGCTAGACATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008808243_1008808246 -1 Left 1008808243 6:55457893-55457915 CCTCACTGGGGCCATGAGTGCAC 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1008808237_1008808246 25 Left 1008808237 6:55457867-55457889 CCAGTGCACCAGAATACGAAAAT 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1008808238_1008808246 17 Left 1008808238 6:55457875-55457897 CCAGAATACGAAAATTTCCCTCA 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1008808242_1008808246 0 Left 1008808242 6:55457892-55457914 CCCTCACTGGGGCCATGAGTGCA 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008808246 Original CRISPR CTTTGTAAGCTAGACATTGT GGG Intronic
903104091 1:21059888-21059910 CTTTGATACCTAGACATTTTTGG - Intronic
904430451 1:30460871-30460893 TTTTGTAAGCTATACATTCTGGG + Intergenic
904703658 1:32374623-32374645 CTTTGCTAGCTAGTCTTTGTAGG + Intronic
908755044 1:67461881-67461903 CCTTGTAAGCTAGACAAGGCAGG - Intergenic
913149566 1:116027252-116027274 CATTGTAACCTTCACATTGTTGG + Intronic
915800357 1:158784990-158785012 GTTTGAAAGCTAGATATTGATGG - Intergenic
917341911 1:173988596-173988618 CTTTATAAGCTTAACATAGTAGG - Intronic
918384682 1:183993705-183993727 CTTTGAATGTTGGACATTGTTGG - Intronic
920726156 1:208437044-208437066 CTTTGCAAGCTATACAGTATAGG - Intergenic
920963697 1:210685171-210685193 CAATGTAAGCTAGAAATTTTGGG - Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1063875438 10:10472634-10472656 AGTTGTAAACTAGACATTGAAGG + Intergenic
1064949797 10:20835830-20835852 CTTTGTATACTAAACATTTTTGG - Intronic
1067171995 10:43914495-43914517 TTTTTTAAGTTACACATTGTGGG + Intergenic
1068190720 10:53649286-53649308 CATACTATGCTAGACATTGTAGG - Intergenic
1070364172 10:75719849-75719871 CTTTATAAGCTGGATATGGTAGG + Intronic
1071674015 10:87638034-87638056 CTCTGTGAGCAAGACATTGCTGG + Intergenic
1074795122 10:116935337-116935359 CTTAGTAAACTAGATATTGATGG - Intronic
1078779770 11:14426183-14426205 TATTGTAAGCTTTACATTGTTGG - Intergenic
1079616606 11:22501788-22501810 CTTTGTAAGCAAGATACGGTGGG - Intergenic
1080704878 11:34681117-34681139 CTTTGTAAACTACCCATTATGGG + Intergenic
1081290025 11:41313272-41313294 TATTGTTTGCTAGACATTGTTGG - Intronic
1086213188 11:84345879-84345901 CTTTGTAGGCCAGACAGTCTCGG - Intronic
1086510473 11:87552154-87552176 CTTAGTAAACTAGATATTGAAGG - Intergenic
1089986116 11:122815674-122815696 CACTGTCAGCTAGACATTCTGGG - Intergenic
1092130701 12:6110838-6110860 CTTTCTAACTCAGACATTGTTGG + Intronic
1096545591 12:52337303-52337325 CTTTGCAAGCTAGAAAAAGTGGG + Intergenic
1098351884 12:69571479-69571501 AGTTGTAAGCTATAGATTGTGGG + Intronic
1100530787 12:95459663-95459685 CTTTGGAAAACAGACATTGTTGG - Intergenic
1103967702 12:124650759-124650781 CTCTGTAAGCAAGAGGTTGTAGG - Intergenic
1106648145 13:31659173-31659195 CCTTATAAATTAGACATTGTTGG + Intergenic
1107000730 13:35541580-35541602 GTTTGTATCCTAGACATTATTGG - Intronic
1107667676 13:42708837-42708859 GTTTTTAATCTAGATATTGTGGG - Intergenic
1111371519 13:87324928-87324950 CAATGGAAGCTAAACATTGTAGG + Intergenic
1113266253 13:108621225-108621247 CTTTGTAAGCTCCACAGGGTAGG + Intronic
1115849022 14:37573079-37573101 CATTTTAAGCTAAAGATTGTTGG + Intergenic
1117182730 14:53208675-53208697 CTTTGTAAACTACCCAATGTTGG + Intergenic
1118322282 14:64760186-64760208 CTGTGTAAGCTTGACTTTTTAGG + Intronic
1120361724 14:83513078-83513100 CTTTGTCAGCTATACATTTCAGG - Intergenic
1120972026 14:90215596-90215618 CTTTGTAAGCTACTCAGTCTTGG - Intergenic
1124941624 15:34223952-34223974 CTTTGTAATCTCAACATTTTGGG + Intergenic
1127088995 15:55448083-55448105 CTCAGTAAGCTAGATATTGATGG - Intronic
1127716444 15:61653467-61653489 TTTTGTAAGCGAAAGATTGTTGG - Intergenic
1131421558 15:92310297-92310319 CTTTATAAGCGAGACAGTGATGG - Intergenic
1133403435 16:5505154-5505176 CAATGAAAGCTTGACATTGTAGG + Intergenic
1134815591 16:17203216-17203238 CTTTGTAAGTTAGTTATTGCAGG + Intronic
1135248864 16:20882825-20882847 TTTTGTAAGCTAAAAAATGTTGG - Intronic
1138201535 16:55091979-55092001 CTTCTGAAGCAAGACATTGTAGG - Intergenic
1139089840 16:63632059-63632081 TTTTGTAAACAACACATTGTTGG - Intergenic
1144872695 17:18380731-18380753 CTCTGTGAGCTAGACCTGGTTGG - Intronic
1145757727 17:27404954-27404976 CTTTGTAAGTTACACAGTCTTGG - Intergenic
1149265995 17:54928265-54928287 CTCTGTATGCCAGACACTGTGGG + Intronic
1149556355 17:57576086-57576108 ATTTGTAAGACAGACACTGTGGG + Intronic
1150818823 17:68418146-68418168 AATTGTAAGCTGGACATTGTTGG + Intronic
1150831326 17:68522281-68522303 CTCAGTAATCTAGACATTCTTGG + Intronic
1158578237 18:58658389-58658411 CTTACTAAGCTACATATTGTTGG + Intergenic
1158909742 18:62047758-62047780 TTTTGAAACCTAGACATTTTGGG - Intronic
925395464 2:3530182-3530204 CTGTGTAAGCGACACAGTGTGGG + Intergenic
928268987 2:29837779-29837801 GATTGTATGCTAGACATTATTGG - Intronic
929700398 2:44157610-44157632 CTTTTTATGCTAAACATGGTAGG - Intergenic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
936415917 2:112311459-112311481 CTATTTAAGGAAGACATTGTAGG - Intronic
938702383 2:133891132-133891154 CTTTGTAAGATGTGCATTGTCGG - Intergenic
939885209 2:147673839-147673861 CTTTCTATGGTAGACATTGAGGG + Intergenic
940009992 2:149042317-149042339 CTTTATATGGTAGACATTGGTGG + Intronic
940765945 2:157789607-157789629 CTCAGTAAGCTTGCCATTGTTGG - Intronic
944150777 2:196555830-196555852 GTTTTGAAGCTAGACCTTGTGGG - Intronic
944250087 2:197573020-197573042 CTTTGTAAACTACACAGTCTCGG + Intronic
1170222666 20:13957496-13957518 CTTTGTAATCTAGACCTTATAGG + Intronic
1170405770 20:16034448-16034470 CTTTTTAAGCTAATGATTGTTGG - Intronic
1172011327 20:31847719-31847741 CTTTGCAAGCTGTACGTTGTAGG - Intronic
1173978343 20:47204213-47204235 CAATGTAATCTGGACATTGTTGG + Intergenic
1174032220 20:47638899-47638921 TTTTGTAAGAAAGACATTCTTGG + Intronic
1175441089 20:58992305-58992327 CTATGTAAGCAATACTTTGTGGG - Intronic
1177773056 21:25538827-25538849 CTTTGTAAGCCTGACAGTGATGG - Intergenic
1181624161 22:24111785-24111807 CATTGTAAGTTGGAGATTGTCGG + Intronic
1183274059 22:36880398-36880420 CATCATAAGCTACACATTGTAGG + Intergenic
1184367012 22:44058141-44058163 CTCTGTAAGCCAGCCAGTGTGGG - Intronic
950458762 3:13108582-13108604 CATTGTGAGCTAGACTTGGTGGG + Intergenic
950993694 3:17470204-17470226 CTTTGTTAGCCAGATTTTGTAGG - Intronic
952193502 3:31048036-31048058 CTTTGTGAGCTGGACTTTGATGG - Intergenic
952271342 3:31834886-31834908 CTGTGTAACCTAGAAAATGTAGG + Intronic
954812629 3:53257392-53257414 CTCTGTAAAATAGGCATTGTAGG - Intergenic
956413555 3:69003585-69003607 CTTTGTAAGTTAGTCAGTCTTGG + Intronic
956896736 3:73668366-73668388 CTTTCTAATCTAGACAATATTGG - Intergenic
957351482 3:79027993-79028015 CTTTGTAATTAAAACATTGTAGG - Intronic
958597262 3:96242978-96243000 CTTTGTAAGCCAGGTATTCTTGG + Intergenic
959088072 3:101872546-101872568 AATTGTATGCTGGACATTGTTGG + Intergenic
960099679 3:113727318-113727340 CTTTAGAAGCTTGACTTTGTAGG - Intronic
962599837 3:136983386-136983408 CTTTGTAAGATAGACCTGGTCGG - Intronic
962797000 3:138858248-138858270 CTTTGTAAGATAGGACTTGTGGG + Intergenic
962824911 3:139091964-139091986 CTTTGTAAGCCAGAGATTTCAGG - Intronic
964710014 3:159661844-159661866 CTTTGGCATCTAGACATTGTTGG + Intronic
965840599 3:172901607-172901629 CTTTGAAATCTGGACATTTTGGG + Intronic
970659350 4:18266401-18266423 CTTTGTAAGCTACCCAGTTTTGG - Intergenic
972806232 4:42531765-42531787 CTTTCTCATCTAGATATTGTTGG - Intronic
973005381 4:44998936-44998958 CTTTGAAATATAAACATTGTAGG - Intergenic
975022550 4:69507043-69507065 CTTTATAAGCTAGGTATTGAAGG + Intronic
975615368 4:76241243-76241265 TTTTGGAAGCCAGACATTGAAGG - Intronic
977166244 4:93702226-93702248 CATTGAAATCTAGACATTCTTGG - Intronic
978681456 4:111386265-111386287 CATTGTATGCTACATATTGTAGG + Intergenic
978808307 4:112823348-112823370 GTTTCTGAGCTAGACAGTGTTGG - Intronic
979016233 4:115437245-115437267 CTTTGTATGGTAGATATTGATGG + Intergenic
980237457 4:130127905-130127927 TTTTGAAAGCCAGAAATTGTAGG + Intergenic
981236350 4:142420232-142420254 CTTTCTAAGTAATACATTGTAGG - Intronic
981495612 4:145388875-145388897 GTTTGCAACATAGACATTGTCGG + Intergenic
982149439 4:152436494-152436516 CTTAGTTAGCTAGACCTTTTAGG - Intronic
983340822 4:166458628-166458650 CTTGCTAACCTAAACATTGTGGG - Intergenic
987542318 5:19271412-19271434 CTTTGGAATCTAGTCATTGAAGG - Intergenic
988051842 5:26041546-26041568 CAGTGTAGGCAAGACATTGTGGG - Intergenic
989536778 5:42573303-42573325 CTTTAGAAGCTAGGCTTTGTGGG + Intronic
995940964 5:117583291-117583313 CTTTGTAATCTGAACATTGTAGG + Intergenic
996406779 5:123113311-123113333 CTATGTATGCTAGGCATTCTTGG - Intronic
997463859 5:134073404-134073426 GTTTTTAAGCTATACATTGGCGG - Intergenic
1000617963 5:163450892-163450914 ATTTGTAAGTTGGACATTTTGGG - Exonic
1008808246 6:55457915-55457937 CTTTGTAAGCTAGACATTGTGGG + Intronic
1010606739 6:77899051-77899073 CTTTGTAAGCTTGAGAATGAGGG - Intronic
1010807607 6:80257628-80257650 GTCTGTAAGCTAGAGATTCTGGG + Intronic
1011208178 6:84924094-84924116 CTGTTTAAGCTAGACATAGCAGG - Intergenic
1013163654 6:107570171-107570193 CTTGGTAAGCTACACTTTGCAGG - Intronic
1020465159 7:8470163-8470185 CTTTGTAAGCCTGACATGTTGGG - Intronic
1020822707 7:12989823-12989845 TATTGAAAGCTAGACATTTTAGG - Intergenic
1021123971 7:16828905-16828927 CTTTGTAGGCAACAGATTGTTGG - Intronic
1028431606 7:90753455-90753477 CTCAGTAAGCTAGGCATTGAAGG + Intronic
1029745824 7:102515411-102515433 CTTTATAAGATAGACATCCTCGG - Intronic
1029763762 7:102614390-102614412 CTTTATAAGATAGACATCCTCGG - Intronic
1032918521 7:136518952-136518974 CTTTGTAAGTTAAAAAGTGTTGG + Intergenic
1033326862 7:140386835-140386857 CTTTGGAAGCTAGGTATGGTGGG - Intronic
1034068891 7:148163738-148163760 CTCTGTCAGCTAGATATTGGAGG - Intronic
1034788916 7:153950245-153950267 GTTTGTCAGGTAGACATGGTAGG + Intronic
1037153145 8:15664045-15664067 CATTGTAAGCTAGTAATAGTTGG + Intronic
1037332849 8:17761591-17761613 ATTATTAAGCTAGACACTGTGGG - Intronic
1037416102 8:18651440-18651462 TTTTCTAAACTACACATTGTAGG + Intronic
1043020267 8:74991430-74991452 CTTTATAAGCTAATCATGGTGGG - Intronic
1046640354 8:116722350-116722372 CTTTGTAAGTTAGCCAGTGTGGG + Intronic
1047726075 8:127685074-127685096 CTTTGTCAGTAAGACATTGGAGG - Intergenic
1049125230 8:140780598-140780620 ATGTGTCAGCTAGACCTTGTTGG - Intronic
1052103551 9:24481379-24481401 CTTTGTAATCTAAACATTATGGG + Intergenic
1053487462 9:38470719-38470741 AGTTGTATGCCAGACATTGTTGG - Intergenic
1055072628 9:72182605-72182627 CTTTGTAAAATAAACTTTGTGGG + Intronic
1055951867 9:81736966-81736988 TTTTTTAAGCTAGCCATTGATGG - Intergenic
1057858170 9:98618294-98618316 TTTTGTAATCTTGACTTTGTGGG + Intronic
1186635427 X:11399170-11399192 GTTTGTAAGTATGACATTGTGGG + Intronic
1187212207 X:17242868-17242890 CTTTGAAAGGTAGAGACTGTTGG + Intergenic
1187630575 X:21165905-21165927 CTTTGGAATCAAGACATTGCAGG - Intergenic
1189973657 X:46441843-46441865 CTTTCTAAGCTAGTCATCCTGGG + Intergenic
1191760254 X:64639398-64639420 CTTAATAAACTAGACATTGAAGG - Intergenic
1191932070 X:66384783-66384805 GTTTGAAAGCTAGACATAGCTGG - Intergenic
1192180173 X:68911311-68911333 CTTTGTAAGCAAGACAGGGTGGG + Intergenic
1193073231 X:77328846-77328868 CTTAATAAGCTAGATATTGAAGG - Intergenic
1193149065 X:78105793-78105815 CTTTGTAATCTGGACAAAGTAGG + Intronic
1194700861 X:97112097-97112119 GTTTGTAGGCCAAACATTGTAGG + Intronic
1197257303 X:124276829-124276851 CTTTGGAAGTTACACATTTTGGG + Intronic
1201930995 Y:19347456-19347478 CTTTGCAAACTAGGCATTGCAGG - Intergenic
1201969595 Y:19776741-19776763 CTTTGTCAGCCAGACAATGAGGG - Intergenic