ID: 1008820395

View in Genome Browser
Species Human (GRCh38)
Location 6:55625124-55625146
Sequence AGTTATCTGCAGAAGACGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008820395_1008820400 16 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820400 6:55625163-55625185 ATAGCTCCTGGCCTGTTAATGGG No data
1008820395_1008820397 4 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820397 6:55625151-55625173 TCCTTTTGAGAGATAGCTCCTGG No data
1008820395_1008820402 25 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG No data
1008820395_1008820399 15 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008820395 Original CRISPR AGTTATCTGCAGAAGACGGC TGG (reversed) Intergenic
No off target data available for this crispr