ID: 1008820399

View in Genome Browser
Species Human (GRCh38)
Location 6:55625162-55625184
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008820396_1008820399 11 Left 1008820396 6:55625128-55625150 CCGTCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG No data
1008820395_1008820399 15 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG No data
1008820394_1008820399 16 Left 1008820394 6:55625123-55625145 CCCAGCCGTCTTCTGCAGATAAC No data
Right 1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008820399 Original CRISPR GATAGCTCCTGGCCTGTTAA TGG Intergenic
No off target data available for this crispr