ID: 1008820402

View in Genome Browser
Species Human (GRCh38)
Location 6:55625172-55625194
Sequence GGCCTGTTAATGGGCTTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008820396_1008820402 21 Left 1008820396 6:55625128-55625150 CCGTCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG No data
1008820398_1008820402 -3 Left 1008820398 6:55625152-55625174 CCTTTTGAGAGATAGCTCCTGGC No data
Right 1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG No data
1008820395_1008820402 25 Left 1008820395 6:55625124-55625146 CCAGCCGTCTTCTGCAGATAACT No data
Right 1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG No data
1008820394_1008820402 26 Left 1008820394 6:55625123-55625145 CCCAGCCGTCTTCTGCAGATAAC No data
Right 1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008820402 Original CRISPR GGCCTGTTAATGGGCTTTTG TGG Intergenic
No off target data available for this crispr