ID: 1008825804

View in Genome Browser
Species Human (GRCh38)
Location 6:55692247-55692269
Sequence ATTCAAACAAGTGTCTATTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008825802_1008825804 22 Left 1008825802 6:55692202-55692224 CCATTCAGGCTATTTTTTCTTGA No data
Right 1008825804 6:55692247-55692269 ATTCAAACAAGTGTCTATTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008825804 Original CRISPR ATTCAAACAAGTGTCTATTT CGG Intergenic
No off target data available for this crispr