ID: 1008826383

View in Genome Browser
Species Human (GRCh38)
Location 6:55699388-55699410
Sequence CTGAATCTATAGAAGGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008826378_1008826383 13 Left 1008826378 6:55699352-55699374 CCAACACTCCCATCCTTGCTTTT No data
Right 1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG No data
1008826379_1008826383 5 Left 1008826379 6:55699360-55699382 CCCATCCTTGCTTTTCTCTAGTT No data
Right 1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG No data
1008826380_1008826383 4 Left 1008826380 6:55699361-55699383 CCATCCTTGCTTTTCTCTAGTTT No data
Right 1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG No data
1008826381_1008826383 0 Left 1008826381 6:55699365-55699387 CCTTGCTTTTCTCTAGTTTTTGT No data
Right 1008826383 6:55699388-55699410 CTGAATCTATAGAAGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008826383 Original CRISPR CTGAATCTATAGAAGGACTG AGG Intergenic
No off target data available for this crispr