ID: 1008831109

View in Genome Browser
Species Human (GRCh38)
Location 6:55763536-55763558
Sequence CAGAATAAGCCGTAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008831105_1008831109 7 Left 1008831105 6:55763506-55763528 CCTGCAGTTAGGTTTACTCTAAA 0: 1
1: 0
2: 0
3: 2
4: 92
Right 1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG No data
1008831102_1008831109 22 Left 1008831102 6:55763491-55763513 CCCAAACTAGAAAAGCCTGCAGT 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG No data
1008831103_1008831109 21 Left 1008831103 6:55763492-55763514 CCAAACTAGAAAAGCCTGCAGTT 0: 1
1: 0
2: 0
3: 20
4: 146
Right 1008831109 6:55763536-55763558 CAGAATAAGCCGTAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008831109 Original CRISPR CAGAATAAGCCGTAGGAGGA AGG Intronic
No off target data available for this crispr