ID: 1008832377

View in Genome Browser
Species Human (GRCh38)
Location 6:55781192-55781214
Sequence TACTTTCTTAAAATAAATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 0, 2: 5, 3: 84, 4: 671}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008832377 Original CRISPR TACTTTCTTAAAATAAATGA GGG (reversed) Intronic
901522427 1:9795640-9795662 TATTTCCTTAAAATAACTTAAGG - Intronic
901613432 1:10517859-10517881 TTCTTTCTTGAAATGAGTGAGGG + Intronic
904226498 1:29025322-29025344 CACTTGCTTGAAATAAATGCAGG + Intronic
904525947 1:31134009-31134031 TACATTTTGAAAATCAATGATGG - Intergenic
905155564 1:35977038-35977060 GATTTTCACAAAATAAATGAGGG - Intronic
905549843 1:38828661-38828683 TACATTCTAAAACAAAATGAGGG - Intergenic
905620026 1:39437222-39437244 TAGATTCTTAAAATAAATATTGG + Intronic
906570928 1:46839169-46839191 TACTTGATTAATACAAATGATGG - Intergenic
906963579 1:50434802-50434824 TAATTTATAAAAATAAATAATGG - Intergenic
907614656 1:55912206-55912228 TACTTACAAAAAAGAAATGAGGG + Intergenic
907812548 1:57886015-57886037 TACTTTTTTAAAAAACATAATGG + Intronic
908053016 1:60253352-60253374 TGATTTGTTAAAATAATTGAAGG - Intergenic
908056078 1:60288845-60288867 GATTTTCTGAAAATAAATAAGGG - Intergenic
908157521 1:61369985-61370007 TACTTTGTTAAAAACATTGATGG - Intronic
908371498 1:63484100-63484122 TACTTTGTTTAAAAAAAGGATGG + Intronic
909147464 1:71954878-71954900 CATTTTCATAAAATAAATGATGG - Intronic
909574101 1:77153865-77153887 TACTTTCTTGAAATATATAATGG - Intronic
909710038 1:78638707-78638729 AACATTCTTGAAACAAATGAAGG - Intronic
909761609 1:79294996-79295018 AAATTTCTAAAAATAATTGATGG + Intergenic
910122964 1:83810558-83810580 TACTGCCTTAAAATAACTTAGGG - Intergenic
910599609 1:89016876-89016898 AACATTCTTAAAAGAAATTAAGG + Intronic
910648157 1:89535609-89535631 TACATTCTTAAAATGGATGACGG - Intronic
910838134 1:91535882-91535904 TACTTTTTTAAAAAAAACGTTGG - Intergenic
910960685 1:92759344-92759366 TACTTTTTTTGAAAAAATGATGG + Intronic
911026734 1:93444591-93444613 TAATTTTTTAAAATAAGAGATGG + Intergenic
911304533 1:96216718-96216740 TTCTGTCTTACAAAAAATGAAGG - Intergenic
911353803 1:96791290-96791312 TGTTTTCTTAAAATATATGTAGG + Intronic
912010923 1:104961299-104961321 TGCTCTATTAAAATAAATGAAGG + Intergenic
912123728 1:106506959-106506981 TATTTTATTAAAATAAATAGTGG + Intergenic
912190364 1:107331692-107331714 AACTTGCTTAAAATAAGCGAAGG - Intronic
912339041 1:108892186-108892208 TACTATTTAAGAATAAATGATGG - Intronic
912617568 1:111120245-111120267 TACTCACTTCAAAGAAATGAGGG - Intronic
912773422 1:112486970-112486992 TATTTACTCAAAAGAAATGAGGG + Intronic
913344575 1:117795433-117795455 TAGTTTCCTAAAATAAATAGAGG - Intergenic
916016948 1:160758309-160758331 TATTATTTTAAAATAAATGCTGG + Intergenic
916545104 1:165796659-165796681 TAATTAATTAAAATAAATAATGG + Intronic
916636646 1:166677104-166677126 TATTTTTTTAAACTAAGTGATGG - Intergenic
916676413 1:167067401-167067423 TACTTTTTTAAAAAAGAAGAAGG - Intronic
916766690 1:167867613-167867635 CAGTTTTTTAAAATAAATTAAGG + Intronic
916943233 1:169698277-169698299 TCCTTTCCTAAAAGAAAGGAGGG + Intronic
917609931 1:176678396-176678418 GATTTTTTTTAAATAAATGATGG - Intronic
917647547 1:177044144-177044166 TCATTTCTTAAAATTAATGATGG - Intronic
917753757 1:178078670-178078692 GAATATTTTAAAATAAATGAGGG - Intergenic
918545097 1:185673248-185673270 AGCTTTCTTGAAATATATGATGG - Intergenic
918551749 1:185750235-185750257 TTCTTTCTTTAAATAAAAGAAGG - Intronic
918667161 1:187165717-187165739 AACTTTCTGAAAATGAAAGAAGG - Intergenic
918684038 1:187392691-187392713 TATTTTTTTAAAATATAAGATGG - Intergenic
918836906 1:189477484-189477506 TAATTGCTTATGATAAATGAGGG + Intergenic
918853008 1:189716923-189716945 TACTCTCTTAAAATATACTAGGG - Intergenic
919094779 1:193019565-193019587 TACTTTCCTTAAGAAAATGAAGG + Intronic
919174033 1:193997488-193997510 TAGATTCTTAAAATAAATTCAGG + Intergenic
919235417 1:194835279-194835301 TACTTTTATGAAATAAGTGAAGG + Intergenic
919596901 1:199575533-199575555 TACTTGCTTAAATTAATTGAAGG - Intergenic
919997354 1:202765205-202765227 TAGTTTATTAAAATAATTTATGG - Intronic
920090464 1:203449312-203449334 TAATTTCTTAAAGAAAATAAAGG - Intergenic
920938924 1:210462478-210462500 TACTATCATAAAATACTTGAAGG - Intronic
921059595 1:211573012-211573034 TCCTTTCTGAAAGAAAATGAGGG - Exonic
921651618 1:217685656-217685678 TGTATTCCTAAAATAAATGATGG - Intronic
921766780 1:218982383-218982405 TACTTTCTTAAAATTCATTTTGG + Intergenic
922365261 1:224857373-224857395 AGCTTTCTTAAAATATTTGAAGG + Intergenic
922610071 1:226920002-226920024 TACTATCATAAAATAAAATAAGG + Intronic
922645199 1:227279276-227279298 TACTATCTTTAAATAAATTCTGG + Intronic
922711004 1:227832391-227832413 CACTTTGTTAACATAAAAGAAGG - Intronic
923177570 1:231481928-231481950 TATCTTCTTTAAATAAATGTTGG + Intergenic
924324910 1:242885950-242885972 GACTTTCTTTAAATAATTGGTGG - Intergenic
1063993069 10:11587287-11587309 TAATTTCTTAAAATATTTTAGGG - Intronic
1064313025 10:14228499-14228521 TGCTTTCTTCAAATAAAACAGGG - Intronic
1064663108 10:17626055-17626077 TATTTACCTAAAAGAAATGAAGG - Intergenic
1065488736 10:26260327-26260349 TATTTTCTTAAAATAACTTCCGG + Intronic
1065529534 10:26654249-26654271 TATTTTCTTAAAATTAAGGAAGG + Intergenic
1065557406 10:26930676-26930698 TATTTTCTTAAAATTAAGGAAGG - Intergenic
1065986555 10:30959436-30959458 TAATTCCTTAAAATAAATTTTGG + Intronic
1066020916 10:31300607-31300629 TAATTTCTTAAGATACATTAAGG - Intergenic
1066359460 10:34716204-34716226 TAATTTCTTAAATAAACTGAAGG - Intronic
1067356514 10:45533573-45533595 AATATTCTTAAAATAAATGGTGG - Intronic
1067491463 10:46708711-46708733 TATTTTTTTTAAATAAATAATGG - Intergenic
1067603198 10:47631667-47631689 TATTTTTTTTAAATAAATAATGG + Intergenic
1068223428 10:54073983-54074005 TGCTTTGTTAAAATAAAGCAGGG + Intronic
1068349846 10:55829300-55829322 TAACTTCATAAAATAAATTATGG + Intergenic
1068412021 10:56668399-56668421 TTCTTTTTTAAAATAAATAAAGG + Intergenic
1068544468 10:58330302-58330324 TTTTTTCTTAAATTATATGATGG - Intergenic
1068626865 10:59258705-59258727 TAATTTCTTTAAAAAAAAGAAGG + Intronic
1068695551 10:59964717-59964739 AACTTTCTCTAAATCAATGATGG - Intergenic
1068849788 10:61724136-61724158 TACTTTCCTGAAAAAAATAAAGG + Intronic
1069091154 10:64200259-64200281 TGCCTTCTTACCATAAATGAGGG - Intergenic
1069234435 10:66052382-66052404 TACTTACTTGAAATGAAGGATGG + Intronic
1069734623 10:70645646-70645668 TGCTTTCTGTCAATAAATGAGGG + Intergenic
1070365292 10:75730791-75730813 TTCTTTCTTCAAAAAAAAGAAGG - Intronic
1070449704 10:76545838-76545860 TACTTTTTAAAAAGAAATAAGGG + Intronic
1070698760 10:78583514-78583536 TAAGTTATTAGAATAAATGAAGG + Intergenic
1070860144 10:79649628-79649650 TATTTTCTCATTATAAATGATGG - Intergenic
1071150173 10:82624868-82624890 TCCTTTCTTAAAATTAATGAGGG - Intronic
1071159780 10:82732332-82732354 TTCATTTTTAAAATAAATCATGG + Intronic
1071513247 10:86280599-86280621 AGCTTTTGTAAAATAAATGAAGG - Intronic
1071533176 10:86404628-86404650 GACTTTATTATAATATATGAAGG + Intergenic
1071755983 10:88540268-88540290 AACTTTCTTAAAGTAAAACAAGG + Intronic
1071792059 10:88965395-88965417 TCTTTCCTTAAAATAAATTAGGG - Intronic
1072412872 10:95220531-95220553 GACTATCTTAAAATGAATAATGG - Intronic
1073195358 10:101686447-101686469 TACTTTCTAAAAATGAACAATGG + Intronic
1073791816 10:106948370-106948392 TAGTTTAGTAAAATAAATGTAGG + Intronic
1074033102 10:109708918-109708940 AACTTTCTTAAATTGTATGAAGG - Intergenic
1074501175 10:114026242-114026264 TATTTTTTAAAAATAAGTGATGG - Intergenic
1075515934 10:123108229-123108251 GACCTTCTTTAAATAAATGGAGG + Intergenic
1076076934 10:127540909-127540931 TAATTTATTGAAATAAATCATGG - Intergenic
1077527122 11:3073805-3073827 TAGTTTGTCATAATAAATGACGG - Intergenic
1077858511 11:6153690-6153712 TATTTTCTAAACTTAAATGAGGG + Intergenic
1077927885 11:6699650-6699672 TTCTTTTTTAAAATGAGTGAAGG - Intergenic
1078620744 11:12905493-12905515 AACTATGTTAAAATAAAGGAGGG + Intronic
1078822325 11:14894486-14894508 TCCTTTCTGAAAATAAATGATGG - Intergenic
1079581948 11:22076221-22076243 TATTTTCTTAAGAAAAAAGATGG - Intergenic
1079620958 11:22553394-22553416 TGCTTTTTTAAAAAAATTGAAGG + Intergenic
1079650830 11:22926937-22926959 TAGTTTTTAAAAATAAATGTGGG - Intergenic
1079939769 11:26664818-26664840 TACTTTCTGAAAAACAAAGAGGG - Intergenic
1080051886 11:27866457-27866479 TACTTCCTCCAAATATATGAAGG - Intergenic
1080250212 11:30225526-30225548 TATTTTCTAGAAATAAAGGAAGG + Intergenic
1080343878 11:31299397-31299419 AACTTTCTTTAAATAAGTTATGG + Intronic
1080576868 11:33607867-33607889 TATTTTTTTTAAATCAATGAAGG - Intronic
1080731985 11:34965901-34965923 TATTTTCTTAAAATAATTTTTGG - Intronic
1080975247 11:37331906-37331928 TATTTTATTAGAATAAATTATGG - Intergenic
1081147517 11:39581347-39581369 TTTTTCCTTAACATAAATGAAGG + Intergenic
1081559320 11:44198375-44198397 TACTTTCTCAAAAAAAAAAAAGG + Intronic
1081582699 11:44363349-44363371 TACTTTGTTTAAAGAATTGAGGG + Intergenic
1081829131 11:46091568-46091590 TACATTCTTAAAATTAATATTGG - Intronic
1082143921 11:48644328-48644350 CAATTTTTTAAAATAAATGGAGG - Intergenic
1082211565 11:49509069-49509091 TAATTTCTTAAAATAAGACAAGG + Intergenic
1082299941 11:50493371-50493393 TACCTTTTTAAAATAATTTAAGG - Intergenic
1082931736 11:58615074-58615096 AACTTTCCTACAGTAAATGAAGG - Intronic
1083039837 11:59675197-59675219 TAATTTCTTAAAATAAGACAAGG + Intergenic
1083250722 11:61464844-61464866 AAGTTTTTAAAAATAAATGATGG - Intronic
1083380082 11:62260023-62260045 TATTTTATTAAAAGAAATAATGG + Intergenic
1083677644 11:64335507-64335529 TACTTTATTAAAATTCAGGAAGG + Intergenic
1085316095 11:75545828-75545850 TACTTTAAAAAAATTAATGATGG + Intergenic
1085419988 11:76348788-76348810 TACATTATAAAAACAAATGATGG + Intergenic
1085577851 11:77623287-77623309 TCCTTTCTTAAAAAAAATCAGGG + Intronic
1085733947 11:79023104-79023126 TAAATTTTTTAAATAAATGAAGG - Intronic
1086215355 11:84373035-84373057 TACTTTAGAAAAATAACTGAAGG + Intronic
1086647089 11:89236287-89236309 TACTTTCTTTAAATATAGGTGGG - Intronic
1086802695 11:91196398-91196420 TACTTGCTTAAAAGAAATGCTGG + Intergenic
1087000207 11:93410724-93410746 TACTTTCTAAAAATAATAAAAGG - Intronic
1087563074 11:99816024-99816046 TAGTCTGTTAAAATAATTGATGG - Intronic
1087949589 11:104204036-104204058 TACTTTATTAAAATAATTTGGGG - Intergenic
1088165738 11:106934383-106934405 CACTTTCTCAAATTAAATTAAGG + Intronic
1088177988 11:107075840-107075862 AACATTGTTAAAATAAATTAAGG + Intergenic
1088254730 11:107892486-107892508 TTCTTTTTTAAAAAAAATTAAGG + Intronic
1089041603 11:115456050-115456072 TAACTTTTTAAAATTAATGATGG + Intronic
1089841417 11:121421587-121421609 TACTTCAATAAAATAAATTACGG + Intergenic
1090144046 11:124300015-124300037 TAGTTTATAATAATAAATGAAGG - Intergenic
1090468949 11:126961490-126961512 AACTGTCTTAAATTATATGAAGG + Intronic
1090626323 11:128611927-128611949 TACTGTCTTAAAATGGGTGACGG + Intergenic
1091363061 11:134993515-134993537 TGTTTTCTTAAAATAAGTAATGG - Intergenic
1092299552 12:7233128-7233150 GACTATCTTAAAATGAATAATGG - Intergenic
1092623555 12:10301095-10301117 AAATTTCATAAAATGAATGAAGG + Intergenic
1092700731 12:11228076-11228098 AAATTTCTTTTAATAAATGAAGG - Intergenic
1093292072 12:17338932-17338954 AACTTTCTTTAAAAAGATGAAGG - Intergenic
1093293113 12:17353796-17353818 TTCTTTCTAAAAAAAAATCATGG + Intergenic
1093416247 12:18924242-18924264 TGCTTTCTTAAAAAAAAGGAGGG - Intergenic
1093534392 12:20205900-20205922 TACTTTCCTAAAAACAATGTTGG + Intergenic
1094390716 12:29947339-29947361 TCCTTTTTGAAAATAAAAGAAGG + Intergenic
1094529827 12:31263743-31263765 CACTTTCTGAAAATAAATTTAGG - Intergenic
1095255807 12:40034499-40034521 TACTGTCTTAAACTAAAAAAAGG + Intronic
1096249966 12:50024782-50024804 TGCTTTCTTAAAAAAAAAAAGGG + Intronic
1097391474 12:59020310-59020332 TACGTTGTTTGAATAAATGATGG + Intergenic
1097398017 12:59100044-59100066 TACTTTCCAAAAATCAGTGATGG + Intergenic
1097659858 12:62417537-62417559 TACTTATTTAGAATAAATGATGG + Intergenic
1097727607 12:63092898-63092920 TACTTTCAGAAAGTAAATGGTGG + Intergenic
1097751029 12:63353196-63353218 TTAGTTCTTAAAATATATGATGG + Intergenic
1098000496 12:65937108-65937130 TAATTTTTTTAAATAAAAGAAGG - Intronic
1098383467 12:69894472-69894494 TAGTTCCTTGAAATAAATTATGG + Intronic
1098759732 12:74408047-74408069 TAATTCCTTAGAATATATGAAGG + Intergenic
1098875166 12:75859389-75859411 TACTTTTTGAAAACAGATGAAGG - Intergenic
1099350286 12:81559127-81559149 TAACTCCTTTAAATAAATGAAGG - Intronic
1100251382 12:92828306-92828328 TGCTCTCTTAAAACAAATGCAGG + Intronic
1100347383 12:93745711-93745733 TATTTTCATATAATGAATGATGG + Intronic
1102165820 12:110805888-110805910 TACTTTATGAAACTACATGAGGG + Intergenic
1103314161 12:120038957-120038979 TAGATTCTTAAAATACATGAAGG + Intronic
1103842317 12:123875209-123875231 TTCTTTTTTAAAAAAAATCAAGG + Exonic
1104132265 12:125905738-125905760 TAGTTTCTCAAGATAGATGATGG - Intergenic
1104593766 12:130105434-130105456 TGCTTTTATAAAATACATGAAGG + Intergenic
1104632086 12:130412138-130412160 GACTGGCTTAAGATAAATGAAGG + Intronic
1105506907 13:21018237-21018259 TACTGTATGAAAATAAGTGAAGG + Intronic
1105592408 13:21805558-21805580 TACTTTCTAAAAAGAAGTAAGGG + Intergenic
1105919548 13:24949247-24949269 GACATTCTTAAAATAAAAAAGGG + Intergenic
1106192636 13:27467075-27467097 AAGGTTCTTAAAATAAATAAAGG + Intergenic
1106278170 13:28235305-28235327 TACTTCCTTTAAATAATTGAAGG + Intronic
1107059588 13:36143655-36143677 TAGTCTCTTAAAATAAATTGAGG - Intergenic
1107400542 13:40064738-40064760 AACCTTCTGAATATAAATGAAGG - Intergenic
1107519884 13:41169237-41169259 CTCTTTCTTAAAAAAAAGGAAGG - Intergenic
1107676564 13:42803857-42803879 TACATTACTAAAATAAATCAGGG - Intergenic
1107693683 13:42978720-42978742 TACTTACTTAAGATAACTAAGGG + Intronic
1108148441 13:47504660-47504682 TACTCTTTTAAAATAAAAGAGGG + Intergenic
1108368983 13:49748135-49748157 TACATTCTTCCAATAAATTATGG + Intronic
1108761785 13:53575995-53576017 TACTATCTTCAAGTATATGAGGG + Intergenic
1108889468 13:55235217-55235239 TAATTTCTTATCATAAATCATGG + Intergenic
1109594095 13:64526450-64526472 TACTTCTTTGAAATAAAAGATGG - Intergenic
1109671175 13:65610363-65610385 TACCTTGTTAGAAGAAATGAAGG + Intergenic
1109768837 13:66942789-66942811 GAGTTTCTTAATTTAAATGATGG + Intronic
1109899308 13:68743676-68743698 TGCTTTCTTAAAATATATTTTGG - Intergenic
1110034621 13:70667282-70667304 AATCTTGTTAAAATAAATGAGGG - Intergenic
1110116777 13:71827373-71827395 TATATTCTTCAAATTAATGAAGG - Intronic
1110204295 13:72894432-72894454 TACTTTTTAAAAAGAAATAATGG + Intronic
1110424586 13:75352588-75352610 TTCTTTCTTAAAATAGTTGTTGG - Intronic
1110746147 13:79055658-79055680 TATGCTGTTAAAATAAATGAGGG - Intergenic
1110771313 13:79350726-79350748 TCTTTTTTTAAAAAAAATGAAGG - Intronic
1111885151 13:94011433-94011455 CATTTTCATAAAATAAATCATGG - Intronic
1112125087 13:96456789-96456811 TACTTTGTTTAAATAAGTCATGG + Intronic
1112144520 13:96682724-96682746 TGATATTTTAAAATAAATGATGG + Intronic
1112342465 13:98564030-98564052 GACATTATTAAAATAAATGGGGG + Intronic
1112623041 13:101071562-101071584 TACTCTCTTCAAATTTATGAAGG - Intronic
1112819877 13:103320087-103320109 AAATTTCTTTAATTAAATGATGG + Intergenic
1112870461 13:103964586-103964608 TAATTTTTTAAAAAAGATGATGG + Intergenic
1112985080 13:105438702-105438724 TACTTACTCAGAATAAATAATGG - Intergenic
1113027661 13:105958663-105958685 TACTTTCTTTTAATAATTAAAGG - Intergenic
1114680312 14:24478809-24478831 TACTTGCTTAAAACACATAAGGG - Intergenic
1114703637 14:24704504-24704526 TACTTACTTGCAATAAATCATGG + Intergenic
1114832087 14:26156699-26156721 TTTTTTTTTAAAATAAATGTAGG - Intergenic
1115388466 14:32825539-32825561 GACTTTCTTAAAAAATTTGATGG - Intronic
1115981716 14:39058882-39058904 TACTTTCTAAACTTGAATGACGG + Intronic
1116045403 14:39736744-39736766 TGCTATCTTAAAATAAAAGTTGG - Intergenic
1116085137 14:40227529-40227551 TACATTTTTAGAATAACTGAAGG - Intergenic
1116145103 14:41056489-41056511 TACTGTCTTTAAATCAATGAAGG - Intergenic
1116182327 14:41550913-41550935 CGTGTTCTTAAAATAAATGATGG + Intergenic
1116261347 14:42631558-42631580 AATTTTCTTATAATAATTGATGG - Intergenic
1116319136 14:43437191-43437213 TGCTTCCTTAAAATTAATGTTGG - Intergenic
1116334846 14:43644228-43644250 TATGTTTTTAAAAAAAATGATGG - Intergenic
1116630843 14:47330014-47330036 TATTTTCTTAAAATAGCTGCAGG + Intronic
1116749606 14:48867044-48867066 TACTTTCAAAAATTAAATGTTGG + Intergenic
1117249466 14:53921980-53922002 TTCTTTCTTAAATTACATAAGGG + Intergenic
1117261320 14:54036694-54036716 TACTTTGTTAATACAAAAGAAGG - Intergenic
1117431536 14:55668853-55668875 TCCTTACTTGAAATAAATGTAGG - Intronic
1117652701 14:57923541-57923563 AACTTTCTTGAAATCTATGAAGG + Intronic
1117713916 14:58561109-58561131 TACTTTCTAAAAATCTATTAGGG - Intergenic
1117743633 14:58845056-58845078 TACTGTCTTAAAATAAATACAGG + Intergenic
1118095261 14:62529880-62529902 CACTTGCTTAAAAAACATGATGG - Intergenic
1118118714 14:62811253-62811275 TGTTTTCTTAAAATATCTGATGG + Intronic
1118581361 14:67302290-67302312 TTTTTTCTTAAGATAACTGAAGG + Intronic
1118829193 14:69413456-69413478 TCCTTTCTTTTAAGAAATGATGG - Intronic
1119284261 14:73438782-73438804 TAATTTTTTAAAATGAATTAGGG + Intronic
1120024440 14:79566940-79566962 TATTATCTTTAAATAAATAAAGG + Intronic
1121449371 14:93997723-93997745 TGCTGGCTTCAAATAAATGATGG - Intergenic
1122236884 14:100335968-100335990 TTTTTTTTTAAAAGAAATGAGGG + Intronic
1123679225 15:22745895-22745917 CATTTTCTTAAAACAAGTGAAGG + Intergenic
1124037376 15:26067686-26067708 AACTTTCAAAAAATAAAGGAGGG - Intergenic
1124104337 15:26723477-26723499 TATTTGCTTAAATTAAATGTGGG - Intronic
1124331446 15:28820345-28820367 CATTTTCTTAAAACAAGTGAAGG + Intergenic
1125195328 15:37039558-37039580 TTCTTTCTTAAAAGCAAAGAGGG + Intronic
1126012057 15:44312486-44312508 CTCTTTGTTAAAATAAAAGAAGG + Intronic
1126269938 15:46803537-46803559 TACAATCTAAAAGTAAATGAAGG + Intergenic
1126302500 15:47213878-47213900 TAATTTCTTAAAATAAAAAGAGG - Intronic
1127628268 15:60801364-60801386 TTCTTTATTAAAACAAATGAAGG - Intronic
1127820646 15:62652561-62652583 TATTTTCTTCAAATATTTGAAGG - Intronic
1128696586 15:69769416-69769438 TAGTTTCTTAAGTTAAATGGGGG + Intergenic
1129655533 15:77522436-77522458 TTCTCTCCTAAAATAAATAAGGG + Intergenic
1129715893 15:77850487-77850509 TACTTTCGTAAATTCATTGAAGG - Intergenic
1130019702 15:80217924-80217946 TCTTTTCTGGAAATAAATGATGG + Intergenic
1130721733 15:86393682-86393704 AACTTTCTAAAAAAAAATGTTGG - Intronic
1130797700 15:87228230-87228252 TCCTTTCTTTGGATAAATGAGGG + Intergenic
1131240436 15:90737438-90737460 TTCCTCATTAAAATAAATGAAGG + Intronic
1131365904 15:91839514-91839536 TATTTTCTTAAATTCATTGAAGG + Intergenic
1131985629 15:98040784-98040806 TACATTATTAAAATTAAGGATGG - Intergenic
1134340049 16:13336535-13336557 TGCTTTCTTAAAATAGTTGGAGG + Intergenic
1134350421 16:13432374-13432396 TACTTTCTAAAAATGACTTATGG + Intergenic
1134825553 16:17281498-17281520 TATGTTGTTAAAAAAAATGATGG + Intronic
1135939489 16:26809200-26809222 TTCTCTCTGAAAATAAAGGATGG + Intergenic
1137255055 16:46768335-46768357 CACTGTCTTAAAAAAAAAGAAGG - Intronic
1138807043 16:60102314-60102336 TACTTTCTCCAAACAAAAGAAGG + Intergenic
1138901067 16:61271186-61271208 GATTTTCTTTAAATAAATGAAGG + Intergenic
1139627522 16:68202509-68202531 TATTTTATTAAAATAAAACAAGG + Intronic
1139792613 16:69452103-69452125 TACTTTTTTAAAGGAAATGATGG - Intronic
1140338332 16:74132967-74132989 TATTTTATGAAGATAAATGATGG - Intergenic
1140600854 16:76473481-76473503 TCCTTTATTAAAACAAAGGATGG - Intronic
1140626559 16:76802100-76802122 TACTTTCTTGAATTAACTCATGG - Intergenic
1143277762 17:5725364-5725386 TACTTGCTTAAACCAAATGAAGG + Intergenic
1144237953 17:13280544-13280566 TATTTGCTTAACAGAAATGATGG + Intergenic
1144471200 17:15542957-15542979 TACTTCCTTAAAACAAAACAGGG - Intronic
1144925266 17:18801736-18801758 TACTTCCTTAAAACAAAACAGGG + Intronic
1145047778 17:19631862-19631884 TACTTTTTTAAAAAAAGAGATGG + Intergenic
1145409021 17:22639472-22639494 TATATTCCAAAAATAAATGAGGG - Intergenic
1146389762 17:32411107-32411129 TAATTCCTAAAAATAAATGTGGG + Intergenic
1146424780 17:32726484-32726506 TATTTTTTTAAAATATATCATGG - Intronic
1146488999 17:33266467-33266489 TGCTTTTTTAAACTAAATGCAGG - Intronic
1147013671 17:37472876-37472898 TAATTAATTAAATTAAATGAAGG + Intronic
1148917569 17:50995279-50995301 TGTTTTCTTAAAATAACTAATGG + Intronic
1149133104 17:53331615-53331637 TACTTTTTTAAAATAATGGAAGG - Intergenic
1149168920 17:53786385-53786407 GACTTTCCAAAAATAGATGATGG + Intergenic
1149277023 17:55052979-55053001 TATTTTCTTAAAAAAAAAAAAGG + Intronic
1150035002 17:61785167-61785189 TACTTTCTGGAAATAACTCATGG - Intronic
1150935950 17:69635909-69635931 TAGTTTCTCAAACTAAAAGAAGG - Intergenic
1151092442 17:71458129-71458151 TACCTTCATAAAATAAGTGAGGG - Intergenic
1152106630 17:78333388-78333410 TATTTTCATAAAACAAATGCAGG - Intergenic
1154384823 18:13883680-13883702 TTATTTCTTAAAATACATGTTGG + Exonic
1154488779 18:14902821-14902843 TGTTTTCTTAAAATAAGTAATGG + Intergenic
1154937552 18:21076709-21076731 TAGTGACTTAAAATAAATTATGG - Intronic
1155444514 18:25897061-25897083 TACTTACTTAAAAAAAAAGTTGG - Intergenic
1156005367 18:32434481-32434503 TACTTTTTTAAAAAAGATGGGGG + Intronic
1156007835 18:32464481-32464503 TACTTTTTTAAAAAAAGAGATGG - Intronic
1156553866 18:38045920-38045942 TTGTTTTTTAAAATTAATGATGG + Intergenic
1156747373 18:40408480-40408502 TCCTATTTTAAAATGAATGAAGG - Intergenic
1157116605 18:44868049-44868071 CACATTCTTATAATAAATGCTGG - Intronic
1157126929 18:44964938-44964960 TACATTTTAAAAATAAATGCAGG + Intronic
1157240995 18:46009216-46009238 TGGTTTCTTTTAATAAATGAGGG - Intronic
1158057164 18:53294985-53295007 TACTTTGTTAAAAAAAATAAAGG - Intronic
1158123662 18:54078480-54078502 TAATTAATTAAAATAAATAATGG + Intergenic
1158194420 18:54868118-54868140 TATTTTATTAAAATAAAAGTGGG + Intronic
1158249991 18:55476998-55477020 TAGTTTCTTGATATCAATGATGG + Intronic
1158253355 18:55515851-55515873 TCCTATCTTAAAATTAAAGATGG - Intronic
1158421710 18:57300487-57300509 TACTTTTTTTATAGAAATGAGGG - Intergenic
1158673976 18:59501811-59501833 CCCTGTCTCAAAATAAATGAAGG - Intronic
1158934243 18:62349796-62349818 TACTTTCCTTAAAAAAATGAGGG - Exonic
1159436948 18:68430479-68430501 TACTTTTTTAAAATAATTGAAGG + Intergenic
1159463161 18:68745436-68745458 TAATTTTTTAAATGAAATGAGGG - Intronic
1159509285 18:69375727-69375749 CATTTTCTTAAAATAAATAACGG + Intergenic
1159517662 18:69478295-69478317 AAATTCCTTAGAATAAATGATGG - Intronic
1159790327 18:72771358-72771380 TAATTTACTAAAATAAATGAGGG + Intronic
1160277881 18:77455465-77455487 TATTTTCTTAAAGTAAAATAAGG + Intergenic
1160570235 18:79811722-79811744 TATTTTCCTGAAACAAATGAAGG + Intergenic
1160889164 19:1368233-1368255 TACTTTCTAAAAATGGATGAAGG + Intronic
1161904224 19:7143128-7143150 CACTTTTTTAAAAAAAATGATGG - Intronic
1162160921 19:8715692-8715714 TAGTTTCTTTAAAGAAATAATGG - Intergenic
1162189487 19:8933550-8933572 CACCTTCATTAAATAAATGATGG + Intronic
1165564989 19:36717724-36717746 TACTTTTATAAGAGAAATGAAGG + Intronic
1165979816 19:39711102-39711124 TATTATCTAAAAATCAATGAAGG + Intergenic
1168379613 19:55908913-55908935 TATTTTAAAAAAATAAATGAAGG + Intronic
925766770 2:7243954-7243976 TACTTTATTAAAATTATTGAGGG - Intergenic
925892061 2:8442292-8442314 TATTTTCTTCAAATACCTGATGG - Intergenic
925949123 2:8894594-8894616 TACTTTCTAAAAAGGAGTGATGG + Intronic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928051307 2:27998818-27998840 TACTTTCTTAAGAGAAACAAAGG - Intronic
928139491 2:28715986-28716008 TACACTCTTAAAATGAATGATGG + Intergenic
928541615 2:32290297-32290319 TATTCTTATAAAATAAATGATGG + Intronic
929182811 2:39061686-39061708 TTCTTTTTAAAAATACATGAAGG - Intronic
929816468 2:45236823-45236845 TGTTTTCTTAAAAAAAATGACGG + Intergenic
929880836 2:45836267-45836289 TACTTTCATAAAATAAGGGGAGG - Intronic
930550269 2:52825894-52825916 TACTTTCTTAAAATAATGTCTGG - Intergenic
930809828 2:55528913-55528935 TACTATCTTTAAAGCAATGATGG + Exonic
931163465 2:59719466-59719488 TCCTTTCTTAAAATACATGGTGG + Intergenic
931522515 2:63114563-63114585 TGCTTTTTTAAAAAAAATCATGG - Intergenic
931543200 2:63352962-63352984 TCCTTTTTTAAAAAAAATCATGG + Intronic
931656680 2:64515730-64515752 AACTATCTTAAAATAAGTTACGG + Intergenic
931901417 2:66792943-66792965 TACTTTTTTAAAAAAAATCAAGG + Intergenic
932949887 2:76280627-76280649 TAATTTATTAAAATAGATGTGGG - Intergenic
933322875 2:80798798-80798820 TACATTTATAAAATAAATGATGG + Intergenic
933386794 2:81621175-81621197 AACATTCTTAAAATACAAGATGG + Intergenic
933936993 2:87214339-87214361 TGCTTTCTTAAAATAAGAGAGGG - Intergenic
934930953 2:98422673-98422695 TGATTTCTTATAATAAATTATGG + Intergenic
935290912 2:101610412-101610434 TCCTTTTATAAAATAAAAGAAGG + Intergenic
935382982 2:102471890-102471912 TTCTTTCTAAAAAGAAATGAGGG - Intergenic
935519976 2:104092728-104092750 TAATTTCTTAAGCTAAGTGATGG - Intergenic
935595747 2:104876176-104876198 TACTTTCTAGAAATAAAGAAAGG - Intergenic
935643595 2:105313559-105313581 TACTTTCATAAAATAAAGTAAGG - Intronic
936356149 2:111751485-111751507 TGCTTTCTTAAAATAAGAGAGGG + Intergenic
936853061 2:116924846-116924868 TACTTTTTTAAAATAAAGGCAGG + Intergenic
937571971 2:123374521-123374543 TGTTTTCTTAAAAAAAATGCAGG - Intergenic
937631218 2:124103333-124103355 TAATTTTTTAAAATAAGTGTAGG + Intronic
937724281 2:125143078-125143100 TACTTGATTAAAATAAAAGTAGG + Intergenic
938670782 2:133584457-133584479 TACTTTTTTTTAAAAAATGAGGG + Intergenic
939025054 2:137002539-137002561 AAATTTCATAAAATAACTGAGGG - Intronic
939186837 2:138871149-138871171 CACTTGCTTTAAATAAAAGAAGG + Intergenic
939772421 2:146337710-146337732 TAATATCTTGAATTAAATGATGG + Intergenic
940391617 2:153139157-153139179 TACTTTCTGAAATAAAATGGTGG + Intergenic
940512149 2:154629558-154629580 TATTTTCTTTAAATAAAAGCAGG + Intergenic
940986222 2:160054854-160054876 TAATTTCTAAAAAAAAATGGAGG + Intronic
941212344 2:162656454-162656476 TATTTTCTTACAAAAAATGATGG - Intronic
941472068 2:165900457-165900479 TAATTTCTGAAAATAATTAATGG - Intronic
941654385 2:168127456-168127478 TTTTTTCTTCAAAGAAATGAAGG + Intronic
941692457 2:168515323-168515345 TACTTTCTTAATTTACATGCCGG - Intronic
941708266 2:168683134-168683156 TAATTTTTTACAATAAATGCTGG + Intronic
942148741 2:173053676-173053698 TTCTATCTTCAAATAAATGTGGG + Intergenic
942240735 2:173963293-173963315 TACATTATTAAAAAAAATGAGGG - Intronic
942356894 2:175125590-175125612 TAGTTTCTTAAAATACATTTTGG - Intronic
942395967 2:175549954-175549976 TACATTTTTAAAAAAATTGAAGG + Intergenic
942871285 2:180737190-180737212 TACTTTGTTCAAATAACTGCGGG + Intergenic
943337877 2:186641204-186641226 TAGTTTCTTAAAAGAATTAAAGG + Intronic
943362712 2:186941682-186941704 TAACTTTTAAAAATAAATGATGG - Intergenic
943373503 2:187046365-187046387 TAATCTCTTTAGATAAATGAGGG - Intergenic
943695938 2:190930576-190930598 TATTTTCTTAATGTAAATAATGG + Intronic
944651804 2:201837812-201837834 TAATTTTTTAAAATCAATTATGG - Intronic
945298389 2:208193364-208193386 TCCTTTCTGACAACAAATGAAGG + Intergenic
945305694 2:208256515-208256537 TAATTTTTTAAAATAAATTTTGG - Intronic
945647227 2:212512788-212512810 TTTTTTCTTAAAATAATTGATGG - Intronic
945660154 2:212675857-212675879 TACTTTGTTGAAATGAGTGATGG + Intergenic
945904284 2:215573916-215573938 TAGTTTTTTAAAAAAAATTAAGG + Intergenic
946129715 2:217597193-217597215 TAGTGTCTTAAAACAAATGTAGG + Intronic
947074758 2:226330435-226330457 TTCTTTCTTAAAATAGAGAAGGG + Intergenic
947227167 2:227851712-227851734 TCCTTTCTTTAATGAAATGATGG - Intergenic
1169936782 20:10892114-10892136 CACTTTCTGACAATAAAAGAGGG - Intergenic
1170027213 20:11902196-11902218 TACATTCTTACAATAAACTAGGG + Intronic
1170687236 20:18580474-18580496 TGCTTTTTAAAAATAAATTAAGG - Intronic
1173261116 20:41437219-41437241 TTCTTTCTTAATATGAAAGACGG + Intronic
1173528132 20:43748376-43748398 CTGTTTCTTAAAATAAAAGAGGG - Intergenic
1173798148 20:45877096-45877118 AACTTTCTTAAGGTAGATGAGGG + Exonic
1174935030 20:54858129-54858151 CAATTTGTGAAAATAAATGAAGG + Intergenic
1175320707 20:58085992-58086014 TACTTTCTCAAAAAAACTTATGG + Intergenic
1176276573 20:64274162-64274184 AACTTACTTAAAATAAGGGAGGG - Exonic
1176658103 21:9606341-9606363 TTCTTTCTTAAAACAAATCTAGG + Intergenic
1176673538 21:9755962-9755984 TACGTTCATAAAATAAACCATGG + Intergenic
1177380466 21:20334886-20334908 CATTTTCTTAAAATAAATTTGGG - Intergenic
1177536575 21:22435706-22435728 TAGTTTACTAAAATAAATGCTGG + Intergenic
1177593132 21:23199927-23199949 TAATATATTTAAATAAATGATGG - Intergenic
1177948456 21:27502464-27502486 TATTTTCTTAAAATGTATTAAGG - Intergenic
1177972070 21:27802594-27802616 TTCCTTGTTAAAATAACTGAGGG - Intergenic
1178218507 21:30628081-30628103 TAATTTCTTAAAATAGCTTATGG + Intergenic
1178448893 21:32673121-32673143 TACTTCATAAAAATATATGATGG - Intronic
1178979563 21:37251391-37251413 TCAGTTCTTAAGATAAATGAAGG - Intronic
1180100676 21:45582807-45582829 TACCTTTTTAAAAAAAAAGAAGG - Intergenic
1180881971 22:19210592-19210614 TACTTTTTTAAAAAAACTGGGGG - Intronic
1181523538 22:23464156-23464178 TATTTCCATAAAATTAATGAAGG + Intergenic
1183879210 22:40812241-40812263 TACTTACTAAAAAAAAAAGATGG + Intronic
1183887738 22:40898962-40898984 TAGTTTATTAAAATGGATGAAGG - Intronic
1184050426 22:41999758-41999780 TCCTGTCTTAAAATAAAAGATGG + Intronic
949275382 3:2273818-2273840 AACTTTCTGAAAATAAAATAAGG + Intronic
949520759 3:4851943-4851965 TCTTTTCTTAAAATAAATCTTGG + Intronic
949656179 3:6222879-6222901 TAATTTTTTATAATAAAGGAAGG - Intergenic
949761021 3:7471047-7471069 TACTTTTTTTAAATAAAGAAGGG - Intronic
950060142 3:10064241-10064263 TACTTTCTTTTTAGAAATGAGGG + Intronic
950196808 3:11015189-11015211 TCCTTTTTTAAAATAGATGTGGG + Intronic
950301509 3:11883464-11883486 TACTTTCTTTTTAGAAATGAGGG + Intergenic
951582747 3:24183159-24183181 AACTATATAAAAATAAATGAAGG - Intronic
951586898 3:24224144-24224166 TACTATGTTAAAGGAAATGATGG - Intronic
951614639 3:24528316-24528338 TAGTTTTTTAAAATAGAGGAGGG + Intergenic
951733032 3:25831939-25831961 TGCTTGCCTAAAAAAAATGAGGG + Intergenic
952320383 3:32271601-32271623 TACGTTCATAAAATAAAATATGG - Intronic
952570918 3:34715045-34715067 GACTCTTTTAAAATAAATGTAGG + Intergenic
952615069 3:35261084-35261106 CACTTTATTGAAATAAGTGATGG + Intergenic
952769212 3:36982397-36982419 AAGTTTCTTAAAAGAAATGGAGG + Intergenic
953466403 3:43124491-43124513 TGACTTCTTAAAATAAATAATGG + Intergenic
954744640 3:52780227-52780249 TATTTTTTTAAAAAAAAAGATGG - Intronic
955554013 3:60116572-60116594 TACTGTCTTGTAATGAATGAGGG - Intronic
956170320 3:66428442-66428464 GAATTTTTTAAAATAAGTGAGGG + Intronic
956552141 3:70473486-70473508 TAATTTCTTAAAATATATACAGG - Intergenic
957179741 3:76861168-76861190 AACTTCCTCAAGATAAATGAAGG - Intronic
957283340 3:78182760-78182782 TAATTTCTGAAAGTAAATGGTGG - Intergenic
957396134 3:79641065-79641087 TAATTTCCTTAAATATATGATGG - Intronic
957575994 3:82009111-82009133 TGCGTTCTTAAAATAAATGGGGG + Intergenic
957642732 3:82878538-82878560 TGCTTTCTAATAATAAATGTAGG - Intergenic
957680375 3:83425845-83425867 TACTTTCTTACAATAACTTTGGG - Intergenic
959055145 3:101560432-101560454 TAGTTTACTAAAATAAAAGAAGG - Intergenic
959543032 3:107562036-107562058 TACTTTCTTCAAACACATCACGG - Intronic
959588326 3:108047620-108047642 TACTTACATTAAATGAATGATGG - Intronic
960102034 3:113753909-113753931 TTTTTTCTTAAGATACATGATGG - Intronic
960444051 3:117725643-117725665 TAATTTCTCAAAATAGATGTTGG - Intergenic
960460500 3:117928616-117928638 TACTTTTTTAAAATTGATGTAGG - Intergenic
960962213 3:123079928-123079950 TTATTTCTAAAAATAAATTATGG + Intronic
962122657 3:132578651-132578673 AACTGTCTTAATATAAATGCTGG - Intronic
962985783 3:140534546-140534568 TATTTACTGAAAATCAATGAGGG + Intronic
963391530 3:144670807-144670829 TACTTTCTGACAAAGAATGATGG - Intergenic
963488248 3:145964412-145964434 TACTTTGTTAAAATACATATTGG - Intergenic
963596368 3:147331524-147331546 TACTTGCTAAAAAGAAAAGAGGG + Intergenic
965107623 3:164377434-164377456 TACTTTTTTTAAAAAAATGATGG + Intergenic
965477553 3:169176157-169176179 AACTTTCTTAAAACATATGAGGG - Intronic
966052715 3:175640676-175640698 TATATTCTTCAAATGAATGATGG - Intronic
966506090 3:180703483-180703505 TACATTCATAAGATAGATGAAGG - Intronic
966576365 3:181507116-181507138 TCCTTTCTTAGAATAAAGGCAGG + Intergenic
967036321 3:185650915-185650937 GACTGTCTCAAAATAAATAAAGG - Intronic
967324197 3:188222910-188222932 TATTTTCTTAAAAAAAATACAGG + Intronic
967333106 3:188311942-188311964 TAGTTTCTTTAAAGAAATGTTGG - Intronic
967384284 3:188895892-188895914 CACTTTTTTAAGAAAAATGAGGG + Intergenic
967516450 3:190374701-190374723 TTCTTTTTGAAAATAAATGATGG - Intronic
967552690 3:190816493-190816515 TACTTTTTTAAAATCCAAGATGG + Intergenic
967998919 3:195187916-195187938 TACTTTTTTAAAAAAAAGGTTGG - Intronic
969327914 4:6454328-6454350 GACTTGCTTGAACTAAATGAAGG + Intronic
970059399 4:12014057-12014079 TACTTTCTTATGACAAGTGATGG + Intergenic
970815194 4:20147444-20147466 TATTTTATTAAAGTAAAAGATGG - Intergenic
971572992 4:28237341-28237363 TACTTTTTTTAAAAAAAAGAAGG - Intergenic
971695078 4:29891089-29891111 TAATCTCTTGAAATAAAAGATGG + Intergenic
971741530 4:30527271-30527293 TACATTCCTTATATAAATGATGG + Intergenic
971773812 4:30933542-30933564 TTCTTTCTTAAAATATATAAAGG + Intronic
974512460 4:62861979-62862001 TTCTTTCTTAAAATTATTAAAGG - Intergenic
974544054 4:63276837-63276859 TACTTCCTGAAATTAAATGTTGG - Intergenic
974738344 4:65970903-65970925 CACTTTCATAAAATAACTTAAGG + Intergenic
974832610 4:67207896-67207918 TAATTTTTTAAAAGAAATAAAGG + Intergenic
974996078 4:69160750-69160772 TATTTTCTTACAAAAAATCAAGG - Intronic
975402312 4:73952328-73952350 TACCTTTTTAAAATAATTTAAGG - Intergenic
976019646 4:80606086-80606108 TACATTTTTAAAATTAATAAAGG + Intronic
976091748 4:81465425-81465447 TTCTTTCTTAAAATTAATTTGGG + Intronic
976167882 4:82274648-82274670 TACTGTGTAAAAAGAAATGAAGG + Intergenic
977597906 4:98903903-98903925 CACTAGCTTAAAATTAATGATGG + Intronic
977700796 4:100020660-100020682 TCCTTTATTAAAAGAAATCAAGG - Intergenic
977710838 4:100123080-100123102 TACTTTTGTAAAATTGATGATGG - Intergenic
978335166 4:107659338-107659360 TACTATATTAAAAGAAAGGATGG + Intronic
978595888 4:110376733-110376755 TAATTTCTTAAACTTGATGAGGG + Intronic
978862813 4:113470938-113470960 GACCTTTTTAAAATATATGATGG + Intronic
978927962 4:114273187-114273209 TAATTTTTTAAAAAAAATTATGG + Intergenic
979158286 4:117426245-117426267 CACTTTTTTCAAAAAAATGAAGG + Intergenic
979425920 4:120566123-120566145 GGCTTTCTTCAAATAATTGATGG + Intergenic
979816491 4:125112477-125112499 TTCTTTCTCAAAAAAAATAAGGG - Intergenic
980033218 4:127854455-127854477 AACTCTCTTAAAACAAAAGATGG - Intergenic
980390673 4:132141954-132141976 GATTATCTTTAAATAAATGAAGG + Intergenic
981032791 4:140142692-140142714 TGCTTTCTTAAAATATTTGAAGG - Intronic
981543957 4:145875178-145875200 TACGTTGTTAAAACAAATGATGG - Intronic
982153477 4:152491278-152491300 TAGTTTTTTAAAAAAATTGAAGG - Intronic
982269105 4:153568719-153568741 TACTCTAATAGAATAAATGAAGG - Intronic
982465959 4:155732615-155732637 TAGATTCTTAAAATAAATAAGGG + Intergenic
982522499 4:156436535-156436557 TAATTCCTGAAACTAAATGATGG + Intergenic
982690644 4:158544117-158544139 TACTTCCTAAATATAAATGAAGG + Intronic
982777699 4:159458910-159458932 TTCTTTCTTTTAATAAATAAAGG + Intergenic
982843489 4:160221565-160221587 TACTTTCCAAAAATAAATCTGGG + Intergenic
982921884 4:161285890-161285912 CACTTTTTCAAAAAAAATGAAGG + Intergenic
983037383 4:162884470-162884492 TACTTTCTAAAAGGAAATTATGG - Intergenic
983382617 4:167017052-167017074 TTCTATCTTGGAATAAATGAGGG + Intronic
983811161 4:172064260-172064282 CACTGTCTTTAAACAAATGAGGG - Intronic
983905810 4:173181603-173181625 TTCTATTTTAAAATAAATGTAGG + Intronic
984027392 4:174559520-174559542 TACCCTCTTAAAAACAATGAAGG + Intergenic
984309595 4:178040226-178040248 TATATTTTTAAAATAATTGATGG + Intergenic
984330902 4:178316533-178316555 TTCTGTATTAAAATAAATGAGGG - Intergenic
984433116 4:179674114-179674136 TTCTTTCATAAAAGGAATGAGGG + Intergenic
984473835 4:180212808-180212830 TTGTTTCATAAAACAAATGATGG - Intergenic
984549186 4:181140560-181140582 CACTTTCTAAAAATAAAAGTTGG + Intergenic
984770838 4:183435193-183435215 TCCTTTCTTAAAATTAATTGAGG + Intergenic
985028577 4:185764796-185764818 TTCTATTTTAAGATAAATGATGG - Intronic
985137804 4:186805487-186805509 TAGTTTATTAGAATTAATGAGGG + Intergenic
985583902 5:717016-717038 TACTGTCTTCACAAAAATGAAGG - Intronic
986041336 5:3996902-3996924 TTCCTTCTTAAAAAAAAAGAGGG + Intergenic
986047017 5:4048598-4048620 GACTTACTAAAAATAAATCAAGG - Intergenic
986115874 5:4773956-4773978 CAGGTTATTAAAATAAATGAGGG + Intergenic
986343912 5:6816896-6816918 TATTTGCTTAACATAAAAGAAGG - Intergenic
986460721 5:7968552-7968574 TACTGTATTTATATAAATGATGG - Intergenic
987091304 5:14510167-14510189 TAATTTTTTAAAATAACTGATGG - Exonic
987200625 5:15573466-15573488 TAGTTTGGTAAAATAAAAGAAGG + Intronic
987468960 5:18307444-18307466 AACTTTCTTAAATTAAATCGAGG + Intergenic
987549339 5:19358334-19358356 TACTTTCTTAAATTATCTGTGGG + Intergenic
987572503 5:19682718-19682740 CTCTCTGTTAAAATAAATGATGG + Intronic
987599970 5:20055146-20055168 TACTATTATAAAATATATGAGGG + Intronic
987826055 5:23032004-23032026 TAACTTTTTAAAATAAATAATGG + Intergenic
987870002 5:23603872-23603894 TACATACATAAAATAAATGAAGG - Intergenic
988094865 5:26592951-26592973 TACTTACTAAAAATAAAATATGG + Intergenic
988312908 5:29584558-29584580 TACTCTCTCAAAACAAAGGATGG + Intergenic
988419713 5:30990397-30990419 TACTTTTTAAAAGTAATTGATGG + Intergenic
988574246 5:32404618-32404640 TGCTTATTTAAAATACATGAGGG + Intronic
988682757 5:33500231-33500253 AACTTTTTTAAAATAAAAAATGG - Intergenic
988896623 5:35681598-35681620 TCCTTTTTTAAAATAAATACTGG - Intronic
988938126 5:36111125-36111147 TTGTCTTTTAAAATAAATGAAGG - Intronic
989062464 5:37422937-37422959 AACTTTCTTAAACAAAATGCGGG + Intronic
989188950 5:38650872-38650894 TCCTTTCTTCAAATACAAGAAGG + Intergenic
989442131 5:41485468-41485490 TTCTTTCTTCAAATACATGAAGG - Intronic
989535328 5:42557097-42557119 AACTTTCTTAAAGTAGACGAGGG + Intronic
989719453 5:44507003-44507025 TAGATTTTTAAAATAAAGGAAGG - Intergenic
990081551 5:51921973-51921995 TACTTTATGACAATAAATCAGGG - Intergenic
990647750 5:57863701-57863723 TGTTTTATTAAAATAAATAAAGG + Intergenic
990798913 5:59577098-59577120 TATTTCCTTAAATTAAATGGAGG + Intronic
991331388 5:65496392-65496414 AAAATTGTTAAAATAAATGATGG + Intergenic
991500088 5:67268207-67268229 CGCATTCTTGAAATAAATGAAGG + Intergenic
992275903 5:75117982-75118004 CAATTTCTAAAAATAAATAATGG + Intronic
992916791 5:81463297-81463319 TACTTTCTTAATAATACTGAGGG - Intronic
993026006 5:82647409-82647431 AGCTTTCTTAAAATAAATGAAGG + Intergenic
993446816 5:88023187-88023209 TTTTTTTTTAAAAAAAATGAAGG - Intergenic
993679951 5:90864523-90864545 TACTCTGTGAAAATAGATGAAGG + Intronic
994127148 5:96180681-96180703 TACTTTTTAAAAATAAAGTAAGG + Intergenic
994386134 5:99134818-99134840 TATTTTCTTCAAAAAATTGATGG + Intergenic
994685797 5:102950200-102950222 TACTGTCTTTGAATAAATGATGG - Intronic
994833874 5:104823110-104823132 TACTTTCTTAAAAGAAAATTTGG + Intergenic
994874887 5:105407837-105407859 TACTCTCTTAAAAGTATTGAAGG + Intergenic
995073910 5:107958910-107958932 CATTTTCTTAAAATAAATTCTGG + Intronic
995576459 5:113540887-113540909 TCCTTTGTTTAAATAAATTATGG - Intronic
995674350 5:114645509-114645531 TATTTTCTTAAAAAAAAGAATGG + Intergenic
995765585 5:115613379-115613401 TATTTTATTAAAATATCTGAGGG - Intronic
996202582 5:120694884-120694906 TATTTTTTTAAAACAAAAGATGG - Intergenic
996291944 5:121861644-121861666 TATTTTTTAAAAATAATTGAAGG + Intergenic
996516559 5:124376443-124376465 TACTCTCTTCAGATAAATGGAGG - Intergenic
996570064 5:124924038-124924060 TACTTTCTTATACTACTTGATGG - Intergenic
996683396 5:126253219-126253241 TACATGCTTATCATAAATGAAGG + Intergenic
997940138 5:138149857-138149879 TACTTGCATAGAGTAAATGAAGG + Intronic
998633781 5:143930154-143930176 TACATTGCTAAAATAAATGCAGG + Intergenic
999588549 5:153118111-153118133 TAATTTCTTAATTTAGATGAAGG - Intergenic
1000366717 5:160498165-160498187 GACTTGCTGAAAATAACTGAGGG - Intergenic
1000606127 5:163329619-163329641 TACTTTCATAAAGTATATAAGGG + Intergenic
1000637689 5:163662457-163662479 TAGTTTCTTACTATAAAGGAAGG - Intergenic
1000881214 5:166700023-166700045 CATTTACTTAAAATAAAAGATGG - Intergenic
1003033342 6:2621647-2621669 TTCTATCTTAAAACATATGAAGG - Intergenic
1003480023 6:6522698-6522720 TTAATTCTTAAAATAAAAGAAGG + Intergenic
1004039621 6:11962606-11962628 TACTCACTTAAAAAAAATGAGGG - Intergenic
1005269900 6:24152620-24152642 TAATTTCTTACAATTAAAGATGG - Intronic
1005602322 6:27440487-27440509 TGCTTTTTTAAATTAATTGAGGG + Intergenic
1005695498 6:28348677-28348699 GACATTTTTAAAACAAATGAAGG - Intronic
1005797859 6:29386531-29386553 TATTTTCTTACATTAAAGGACGG - Intronic
1006064352 6:31452835-31452857 TAATAAATTAAAATAAATGAAGG - Intergenic
1006710633 6:36066435-36066457 TGCTTACCTAAAATAACTGAAGG + Intronic
1007722913 6:43896070-43896092 TGCTTTCCAAAAGTAAATGAAGG + Intergenic
1007971721 6:46058501-46058523 TTCTTTGTTAAAATGAATCATGG - Intronic
1008320065 6:50101139-50101161 TAATTTCTTACAACAAATGAAGG - Intergenic
1008358257 6:50581863-50581885 CACTTTATTAGAATAAATGTGGG - Intergenic
1008569324 6:52800267-52800289 AACTTTCTCAGAGTAAATGATGG + Intronic
1008813777 6:55538463-55538485 AACTCTCTTAAAATTAATGGTGG + Intronic
1008832377 6:55781192-55781214 TACTTTCTTAAAATAAATGAGGG - Intronic
1009292474 6:61901212-61901234 TTCTTACTTTAAATAAATTAAGG - Intronic
1010789283 6:80046442-80046464 CACTTTCTTAACATGAATAAGGG - Intergenic
1011205306 6:84887799-84887821 TCCTTTGCTAAAAAAAATGAAGG + Intergenic
1011290804 6:85774910-85774932 AAATTTCTTGAAAGAAATGATGG - Intergenic
1011472410 6:87721218-87721240 TACTATTTTAAAATTAAAGAAGG + Intergenic
1011866856 6:91839797-91839819 TCCTTTCGTAGAATAAATAAGGG + Intergenic
1012063772 6:94520310-94520332 TACTTTTTAAAAATGAATCATGG - Intergenic
1012442017 6:99269761-99269783 CATTTTCTTATAAAAAATGAGGG - Intergenic
1012626593 6:101411486-101411508 TACTTTGGTAAAATAAATAAAGG - Intronic
1012681661 6:102190334-102190356 TTCATTTTTAAAATAAATGAAGG - Intergenic
1012849797 6:104432802-104432824 TACTTTCTTAATTTTAATGGAGG - Intergenic
1012995639 6:105970505-105970527 TGCGTACTTAAAATAATTGAAGG - Intergenic
1013239205 6:108227900-108227922 AACTTTCATAAAATGATTGAAGG + Intronic
1013477216 6:110520175-110520197 TACTTTCTAAAAATTCATTAAGG + Intergenic
1014138161 6:117911186-117911208 TAATTTTTTAAAATAATTAATGG + Intronic
1014522072 6:122456676-122456698 TACTTAATGAAAAAAAATGATGG - Intronic
1014682819 6:124453839-124453861 TACTTTTTTTAACTATATGATGG - Intronic
1014942449 6:127458844-127458866 TACTTAGTGAAAATCAATGATGG + Intronic
1015146499 6:129993489-129993511 TTTTTTTTTAACATAAATGAAGG + Intergenic
1015321960 6:131886527-131886549 TTCTTTCTTAAAATGAATATTGG + Intronic
1015357028 6:132290137-132290159 TATCTTCTTAAAATAACTAATGG + Intergenic
1015435339 6:133179926-133179948 TTCTTTTTTAAAATAGCTGAAGG + Intergenic
1015547644 6:134377647-134377669 TAATTTTCTAATATAAATGAGGG + Intergenic
1015776413 6:136819394-136819416 CACTATCTTCAAATATATGATGG - Intergenic
1016269371 6:142270775-142270797 AACTTTCTTAAAATATATTCAGG + Intergenic
1017280486 6:152619153-152619175 AAGTTTCTTAAGATATATGAGGG + Intronic
1017305732 6:152916409-152916431 TACCTTTTTAAAATAATGGAAGG + Intergenic
1017343237 6:153350866-153350888 TACTTAATTAAAAAAAACGAAGG + Intergenic
1017683124 6:156883953-156883975 TACTTTATCAGAATAAATGAGGG - Intronic
1018062286 6:160099881-160099903 CATTTTCTTGAAAGAAATGAAGG + Intronic
1018350367 6:162952153-162952175 TAATTTCTTACAATAAACGGAGG - Intronic
1018405495 6:163477476-163477498 TACTTTGTTAAAATGGATCATGG + Intronic
1019543789 7:1563168-1563190 TAATTTCGTAAAAAAAATAAAGG - Intergenic
1019656622 7:2199500-2199522 CACTTTCTTTAAATCATTGATGG + Intronic
1020513459 7:9088687-9088709 TACATTCTTAAATTTAATTAAGG - Intergenic
1020708150 7:11571262-11571284 TCCTTTCAGAAAATAAATCAAGG - Intronic
1021320781 7:19208202-19208224 TCCTTTCTTACAATACATAAAGG + Intergenic
1021472492 7:21020964-21020986 TATTTTCTTAACAAAAATGAAGG + Intergenic
1021648792 7:22812518-22812540 TAGTTTCCTAATATAACTGAGGG + Intergenic
1022160950 7:27710692-27710714 TACTTTCTTAAAATATTTGCAGG - Intergenic
1022197976 7:28087969-28087991 TAATTGCTTAAAAGAAATAAAGG - Intronic
1022484121 7:30764934-30764956 CAATTCCTTAAAATAAATCAAGG - Intronic
1022607188 7:31827070-31827092 TACTTTCTTGTAGGAAATGAGGG - Intronic
1022820306 7:33953336-33953358 TTCATTCTTCAAATAACTGAGGG - Intronic
1022851914 7:34272375-34272397 TACTTTTTTAAAATTAAAAATGG + Intergenic
1023161122 7:37296811-37296833 TCCTTTCTTATAATAAATACTGG + Intronic
1023237345 7:38103992-38104014 TAATTTCCTAAAACAAATTATGG - Intergenic
1023592302 7:41793220-41793242 AACAATCTTAAAACAAATGAGGG - Intergenic
1024088154 7:45914173-45914195 TTTTTTCTTTTAATAAATGAGGG - Intronic
1026096418 7:67349939-67349961 TGCTTTCATTAAATAAAAGAGGG - Intergenic
1026122859 7:67552627-67552649 TACTTTCTTAAAAGAAACTATGG + Intergenic
1027719769 7:81725437-81725459 TACTTGCTTAACATATAAGAAGG - Intronic
1027721383 7:81746244-81746266 TAATGTATTAATATAAATGAAGG - Intronic
1028370228 7:90083478-90083500 TGCTTACTGAAAATGAATGATGG + Intergenic
1028647598 7:93115733-93115755 TACTTGCATAAAAAAGATGATGG + Intronic
1028809094 7:95063194-95063216 AACATTCTTACAATAAATAAAGG - Intronic
1029801228 7:102949595-102949617 TGCTTCCTTAAAAAAAATCAAGG + Intronic
1030460650 7:109830948-109830970 TACTTTCGTAAAATACTTAAAGG - Intergenic
1030729775 7:112972856-112972878 TAATTTCATAAATTACATGAAGG - Intergenic
1031045248 7:116880126-116880148 TTTTTTTTTAAAGTAAATGAAGG + Intronic
1031436075 7:121733476-121733498 TTCTTTATCAAAACAAATGAAGG - Intergenic
1031438908 7:121768583-121768605 TAGTTTGTTAAAATTATTGATGG + Intergenic
1031447863 7:121876327-121876349 TAATTTCTTCCAATTAATGAAGG + Intronic
1031523048 7:122789603-122789625 TACTTTCTTAAAACATATTGTGG - Intronic
1031600480 7:123701957-123701979 TTCTTTCATTAAATAAATGGAGG - Intronic
1031970330 7:128060502-128060524 CACCTGCTTAAAATAAAGGATGG + Intronic
1032717389 7:134521340-134521362 CATTTTATTAAAATAAATAAAGG - Intergenic
1032793644 7:135260353-135260375 CAATTTCTTAAAATAAATCTCGG - Intergenic
1033032539 7:137841488-137841510 TAGTTACTGCAAATAAATGATGG - Intronic
1033395403 7:140969395-140969417 TACTAAGTTAAATTAAATGATGG - Intergenic
1033516882 7:142115539-142115561 TACTTTTTTAAAATAAAGTAAGG + Intronic
1033639013 7:143242815-143242837 GATTTTTTTAAAAAAAATGAAGG + Intergenic
1033947754 7:146742947-146742969 TACTTTTTTTAAAAAAATGAAGG - Intronic
1034036447 7:147828544-147828566 TAATTTGATAAAATACATGAAGG + Intronic
1036071341 8:5443241-5443263 CACTTTCATAAAATAAAAGAAGG - Intergenic
1036112870 8:5924069-5924091 TGATTTCTTAACAGAAATGATGG + Intergenic
1036196180 8:6717016-6717038 TTCTTTCCTTAAATAGATGAAGG + Intronic
1037791146 8:21943498-21943520 AAATTTCTTCAAATAAATTATGG - Intronic
1037914156 8:22762144-22762166 TCTTTTCTTTAAATTAATGAAGG - Intronic
1038074337 8:24053971-24053993 GACTTTTTTAAAAAAAATTAGGG + Intergenic
1038522658 8:28246668-28246690 CAGTTCCTTAAAATAAATGTAGG + Intergenic
1038707235 8:29905945-29905967 TACTTTCTTCAAATATTTGAAGG + Intergenic
1039687845 8:39826050-39826072 AACATTCTTAAAAGAAATGAAGG - Intronic
1040416968 8:47203786-47203808 TTCTTTCTTAAAATGAGTGTCGG + Intergenic
1040594132 8:48821394-48821416 TACTCTCTTATAATTAAAGATGG - Intergenic
1040732623 8:50468467-50468489 TACTTTGCTAACATTAATGAAGG - Intronic
1040966319 8:53084542-53084564 TATTTTCTTAAAGGAAATGATGG + Intergenic
1041496762 8:58494143-58494165 CATTTTCATAAAATAAAGGAGGG - Intronic
1041529369 8:58846225-58846247 TTTTTTTTTAAAATAAATAAGGG + Intronic
1041789177 8:61672778-61672800 TATTTTCATAAGTTAAATGATGG - Intronic
1041868450 8:62604862-62604884 TTCTTTCATTAAACAAATGATGG + Intronic
1041950330 8:63494005-63494027 AACTTAATTAAAATTAATGAAGG - Intergenic
1043505916 8:80902279-80902301 TACCTACTTAACATAAAAGAAGG + Intergenic
1043534276 8:81184485-81184507 TACTTTCTAAAAATAGTTAAAGG + Intergenic
1043848879 8:85193078-85193100 TACATACATAAAATAAATGTTGG + Intronic
1044056606 8:87578509-87578531 CACTATCTTAAAATAAGGGAAGG - Intronic
1044103545 8:88172196-88172218 AACTTTCATAAAAAAAATGAGGG - Intronic
1044176056 8:89124054-89124076 TCCTTTCTTAACATCATTGATGG + Intergenic
1044254367 8:90043150-90043172 TCCTTTTTTAAAAAAAATCAAGG + Intronic
1044490216 8:92804935-92804957 TACCTTATTATAATAAAAGATGG + Intergenic
1044834347 8:96281173-96281195 TACTTTTTTAAAAAAAATCGAGG - Intronic
1044866448 8:96575581-96575603 TTCTTTCTTTAATTAAATTAAGG + Intronic
1045440680 8:102206748-102206770 TACTTACTAAAAATAAATAGGGG + Exonic
1045614379 8:103891154-103891176 TACTCTTTTTAAAAAAATGATGG - Intronic
1045911302 8:107413727-107413749 TAATTTTTTAAAATTCATGATGG + Intronic
1046427911 8:114079749-114079771 AACTTTTTTAGAATAAATGAAGG + Intergenic
1047695530 8:127400116-127400138 CACTTTCTTTTAACAAATGAAGG - Intergenic
1047818364 8:128490152-128490174 AACTTACTTAAAATAAGGGAGGG - Intergenic
1048081153 8:131128705-131128727 TACTTTCTTGAAATATTTCAGGG + Intergenic
1048467656 8:134680478-134680500 ACCTTTTTTAAAAAAAATGAGGG + Intronic
1048628781 8:136217315-136217337 TAATTTCACTAAATAAATGAGGG - Intergenic
1049020951 8:139957383-139957405 TTTCTTTTTAAAATAAATGAAGG + Intronic
1049380326 8:142310667-142310689 GACTTTCTTAGAAGAAACGATGG - Intronic
1050221270 9:3393171-3393193 TACTATATTTAAATAAATGGAGG + Intronic
1050360428 9:4825537-4825559 GACTTTCATAAAATAAATGTAGG - Intronic
1050399458 9:5235946-5235968 TACTTTCTTAAAGCAGCTGAAGG - Intergenic
1050490503 9:6183333-6183355 TGACTTCATAAAATAAATGAAGG - Intergenic
1050765496 9:9128051-9128073 TACTTTTTTAAAAAAGATGTGGG + Intronic
1051265444 9:15305154-15305176 GACTTTCTACAAATAAATCAAGG + Intronic
1052303355 9:26977285-26977307 TACTTTTTTAAAACAAAAAAAGG - Intronic
1052401819 9:28010646-28010668 TACTGTTTTAAAATCAATCAAGG + Intronic
1052591558 9:30503240-30503262 TACCTTTTGAAGATAAATGAGGG - Intergenic
1052635234 9:31094553-31094575 TAATTACTAAAAATAAAAGATGG + Intergenic
1052719685 9:32158495-32158517 TACTTTCTTTAAAAATATCAAGG + Intergenic
1052836521 9:33254287-33254309 TAATTTTTTAAAAACAATGATGG + Exonic
1053514358 9:38717240-38717262 GATTTTCTTTGAATAAATGATGG - Intergenic
1054318467 9:63626252-63626274 TGCTTACTTATAATAATTGAAGG + Intergenic
1054829902 9:69612301-69612323 TAATTTTTAAAAATAAATTAGGG + Intronic
1055779876 9:79808849-79808871 TAATTTTTTGAAAAAAATGATGG - Intergenic
1055838520 9:80474341-80474363 AATGTCCTTAAAATAAATGATGG - Intergenic
1057359046 9:94356753-94356775 TTCTTTTTTAAAATGAATAATGG + Intergenic
1057648711 9:96900837-96900859 TTCTTTTTTAAAATGAATAATGG - Intronic
1058195652 9:101971665-101971687 TAGTTTCTTAACATAAAAAAAGG - Intergenic
1058203138 9:102068173-102068195 TAATTACTTGAAAGAAATGATGG - Intergenic
1059206258 9:112469055-112469077 TACTTACAAATAATAAATGAAGG - Intronic
1061735302 9:132652081-132652103 TAGCTTCTTAAAAAAAATAAAGG + Intronic
1203635831 Un_KI270750v1:109916-109938 TTCTTTCTTAAAACAAATCTAGG + Intergenic
1185784242 X:2876636-2876658 AACTTTTTTAAAAAAACTGATGG - Intronic
1186183931 X:7001074-7001096 TACATTATTAGAATTAATGAGGG + Intergenic
1186235839 X:7508495-7508517 TACTTTATGAAAATAATGGATGG + Intergenic
1187124879 X:16445695-16445717 TGCATCCTTAAAACAAATGAGGG - Intergenic
1187207831 X:17199599-17199621 TACTCTGCTAAAATAAATGATGG - Intergenic
1187452832 X:19413742-19413764 TACTTTGTTAAAAGAGAGGAGGG + Intronic
1187763871 X:22617961-22617983 AATTTTATTCAAATAAATGAAGG + Intergenic
1188043891 X:25403277-25403299 AATTTTCTTAAAATAAATGATGG + Intergenic
1188068516 X:25691553-25691575 AAATTTCTTAAAACAAATAACGG - Intergenic
1188196100 X:27236587-27236609 CATTTAGTTAAAATAAATGAAGG - Intergenic
1188328710 X:28841148-28841170 TACTTTGCTAAAATAAAAAATGG - Intronic
1188380116 X:29481334-29481356 TGCTTTTTTAAAATGACTGAAGG - Intronic
1188578903 X:31686671-31686693 AACTTTCTTAAAATAACTATAGG + Intronic
1188906346 X:35796716-35796738 TATTTTCTTAAACTAGATCAAGG - Intergenic
1189433789 X:40973131-40973153 TACTTTCTTAATAAAAGTAAAGG + Intergenic
1189837131 X:45036457-45036479 TACTTTCTTAAATGAAATTCAGG + Intronic
1189922085 X:45912494-45912516 TACTTTCATAAAAGAAATCGTGG - Intergenic
1190384976 X:49876659-49876681 TACATTTTTAAAACAGATGATGG + Intergenic
1191238898 X:58163037-58163059 TTTTTTCGTAAAATATATGAAGG + Intergenic
1192414798 X:70969622-70969644 TAGTTTTTAAAAATAAATGTCGG + Intergenic
1194096696 X:89649067-89649089 TATTTTCTTATAATAAAAGTAGG - Intergenic
1194522804 X:94939185-94939207 TACTTTCACAAAATAAATGTAGG - Intergenic
1194576901 X:95624439-95624461 TGCTTTTTTAAAAAAAATGGGGG - Intergenic
1194768345 X:97869802-97869824 GAGTTTCTTAAAATTAATGACGG - Intergenic
1194851610 X:98876957-98876979 TACTTTCTTGAAACACATGAAGG - Intergenic
1194915060 X:99696305-99696327 TATTTTTTTAAAATAAAGAATGG + Intergenic
1195591481 X:106633098-106633120 TAGAATATTAAAATAAATGAAGG - Intronic
1196440573 X:115716145-115716167 TAATTTGTTAGAATCAATGATGG - Intergenic
1197033735 X:121849723-121849745 TAACTTCTTAAAATACAAGAAGG + Intergenic
1197161567 X:123328856-123328878 TATTTTCGTAAAATAAATTACGG - Intronic
1197739523 X:129879198-129879220 TACTTTCAAAAAACAAAAGATGG - Intergenic
1197870192 X:131057357-131057379 TTCTTTCTAAAAATAAATGTGGG + Intergenic
1197992971 X:132338191-132338213 TACTTACTTGAAATGGATGATGG + Intergenic
1198429641 X:136552898-136552920 CACTATCCTAAAATAAAGGAAGG + Intronic
1199331312 X:146563171-146563193 TACTTAATTTAAGTAAATGATGG + Intergenic
1200359633 X:155590539-155590561 TACTTTAATAACATAAAAGAAGG + Intronic
1200449715 Y:3310441-3310463 TATTTTCTTATAATAAAAGTAGG - Intergenic
1201435919 Y:13958477-13958499 TACTTTTTTTAATTAAAAGAAGG + Intergenic
1201784996 Y:17766266-17766288 CACTTTCTTAAAAAAAAGAAAGG + Intergenic
1201816556 Y:18139721-18139743 CACTTTCTTAAAAAAAAGAAAGG - Intergenic
1202054093 Y:20811133-20811155 TAATTTCTTAAAATCATTGAGGG - Intergenic