ID: 1008837047

View in Genome Browser
Species Human (GRCh38)
Location 6:55846350-55846372
Sequence TTGGTGTTATTGAAGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 458}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008837047 Original CRISPR TTGGTGTTATTGAAGACACA TGG Intronic
900282478 1:1879936-1879958 TTGTTGTTTTTTAAGACATAGGG + Intronic
901119653 1:6880560-6880582 TTTGTGTTTTTGTAGAGACAGGG + Intronic
902324666 1:15691934-15691956 TTTTTATTTTTGAAGACACAGGG - Intronic
902921483 1:19668255-19668277 TTGTTGTTTTTTAAGAGACAGGG + Intronic
904193461 1:28765622-28765644 TTGTTGTTGTTGTAGAGACAGGG + Intronic
904881238 1:33698702-33698724 TTGGTATTATGGGAGACCCAAGG + Intronic
905483682 1:38280378-38280400 TTTGTATTTTTGTAGACACAAGG + Intergenic
906658672 1:47567101-47567123 TTGGTGTCAATGAAGAGACTAGG - Intergenic
907690748 1:56663100-56663122 TTGTTGTTTTTTAAGAGACAAGG + Intronic
907781722 1:57573092-57573114 TTGGTGTTTTTTTAGAGACAGGG + Intronic
907945529 1:59133014-59133036 TTGGTGGTCTTGAAGTCACAGGG - Intergenic
908150599 1:61297628-61297650 AGGGTGCTGTTGAAGACACATGG + Intronic
908259976 1:62332672-62332694 TTTGTGTTTTTGAAGAGACGAGG - Intergenic
909096398 1:71293414-71293436 TTTGTGTTTTTGGAGAGACAGGG - Intergenic
909312120 1:74165026-74165048 GTGGTGGTATTGATAACACATGG - Intronic
910767766 1:90799885-90799907 ATGGTGTTTCTGCAGACACATGG + Intergenic
910905945 1:92178657-92178679 TTGTTGTTATTGTTGAGACAGGG + Intronic
912941470 1:114048964-114048986 TTTGTGTTGTTGTAGAGACAGGG + Intergenic
914242980 1:145864734-145864756 TTGTACTTTTTGAAGACACAGGG - Intergenic
915244744 1:154548482-154548504 TTGGTGTTATGCAACTCACAGGG + Intergenic
915699836 1:157781328-157781350 TTGGTGTAGTTGATGACCCATGG - Intergenic
916093992 1:161331979-161332001 TTTGTTTTATTTAAGAGACAGGG + Intronic
916206788 1:162322608-162322630 TTGGTTTATTTGAAGAAACATGG + Intronic
916653780 1:166854621-166854643 TTGGTATCTGTGAAGACACAGGG + Intronic
916932918 1:169598041-169598063 TGGGAGTTATGGAAGACTCAAGG - Intronic
917731895 1:177882766-177882788 TTGGTGTTGTTGAAGCCTCCCGG - Intergenic
918560779 1:185864703-185864725 TTATTGTTATTGACCACACATGG - Intronic
919160344 1:193821852-193821874 TTGGTGGTATTTAAGTCATAAGG - Intergenic
919341441 1:196312732-196312754 ATGGTGTTCTTTAAGATACAAGG + Intronic
920616613 1:207498704-207498726 TTTGTGTTTTTGTAGAGACAGGG - Intronic
920979956 1:210823971-210823993 TTGTTGTTGTTGTAGAGACAAGG + Intronic
921100164 1:211921909-211921931 TTGTTGTTTTTGCAGAGACAGGG - Intergenic
921960067 1:221025201-221025223 TTGATCTTTTTGTAGACACAGGG + Intergenic
922311755 1:224399965-224399987 TTGTTGTTTTTTAAGAGACAGGG - Intronic
922511372 1:226170949-226170971 TTTGTGTTTTTGTAGACAGAGGG + Intronic
922545276 1:226452081-226452103 TTGTTTTTATTGTAGAGACAGGG + Intergenic
923425233 1:233862208-233862230 TTGGTGACATAGAAGTCACAGGG + Intergenic
923579852 1:235198925-235198947 TTTGTGTTTTTGTAGAGACAGGG - Intronic
924075191 1:240326545-240326567 TTTGTGTTGTTTAAGACCCAGGG + Intronic
924144359 1:241058599-241058621 TTGAAGTTATTGGAGTCACATGG - Intronic
924370999 1:243349566-243349588 TTGTTATTATTTAAGATACATGG - Intronic
1063499677 10:6542100-6542122 TTGCTCTTAGTGAAAACACAAGG - Intronic
1063523316 10:6760598-6760620 TTGGAAATATTGAAGAAACAAGG + Intergenic
1063706486 10:8435942-8435964 TTGGTGTGACTGCTGACACATGG - Intergenic
1064046602 10:12022237-12022259 TTTGTGTTTTAGAAGAGACAGGG - Intronic
1065011941 10:21428769-21428791 TTGTTGTTGTTGTAGATACAGGG - Intergenic
1065097061 10:22292043-22292065 TTTGTATTTTTGTAGACACAGGG - Intergenic
1065129076 10:22602218-22602240 TTGTAATTTTTGAAGACACAGGG - Intronic
1065377150 10:25054846-25054868 TTTGTGTTTTTGTAGAGACAGGG + Intronic
1065619332 10:27563910-27563932 TTTGTGTTGTTGTAGAGACAGGG + Intergenic
1068075086 10:52242722-52242744 TTTGTGTTGTTGTAGAGACAGGG - Intronic
1068146394 10:53076367-53076389 TTTCTGTTATTGAAGCCACTTGG + Intergenic
1069468544 10:68664558-68664580 TGTGTTTTATTGAAGAGACAAGG + Intronic
1070008710 10:72451550-72451572 TTGTTGTTTTTTAAGAGACAGGG + Intronic
1070904149 10:80056959-80056981 TTGGTTTTTTTGTAGAGACAGGG - Intergenic
1071543345 10:86508086-86508108 TTGGTGTCACTAAAAACACATGG - Intronic
1072261441 10:93678654-93678676 TTGTTGTTGTTGCAGAGACAGGG - Intronic
1072319837 10:94238246-94238268 TTGTTGTTGTTGTAGAGACAAGG - Intronic
1072418551 10:95269907-95269929 TTTGTGTTTTTGTAGAAACAGGG + Intronic
1073399981 10:103249428-103249450 TTGTTCTTATTGAAGAAATAAGG + Intergenic
1073402282 10:103268176-103268198 TTGGTGTTTTAGTAGAGACAAGG - Intergenic
1074184504 10:111088895-111088917 CTTGTGCTATTGAAGACACAAGG - Intergenic
1074414655 10:113256793-113256815 TTAGTGTTATTTAAAAGACAGGG + Intergenic
1074805967 10:117052843-117052865 TTGGTATTTTTGTAGAGACAGGG - Intronic
1075185131 10:120249023-120249045 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
1076134295 10:128034988-128035010 TTGTTGTTGTTGTTGACACAAGG + Intronic
1077180664 11:1212362-1212384 TCTATGTTATTGAATACACAAGG + Intergenic
1077624360 11:3757313-3757335 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1077736490 11:4797289-4797311 CTGGTTTTATTAAACACACATGG - Intronic
1078174173 11:8956724-8956746 TTGTTGTTTTTTAAGAGACAAGG + Intronic
1078241178 11:9531884-9531906 TTGGTATTTTTGTAGAGACAGGG + Intergenic
1078243042 11:9547883-9547905 TTGTTGTTGTTGTAGAGACAAGG - Intergenic
1078715929 11:13838945-13838967 CTGCTGGTTTTGAAGACACAAGG - Intergenic
1079218223 11:18534220-18534242 CTGGTGATACTGAAGACACCTGG + Intronic
1080559564 11:33450553-33450575 TTGTTGTTGTTTAAGAGACAGGG - Intergenic
1080857261 11:36123001-36123023 TTGTTGTTGTTGTAGAGACAAGG - Intronic
1081982309 11:47275461-47275483 TTGGTATTTTTGTAGAGACAAGG + Intronic
1082631014 11:55542023-55542045 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1082647256 11:55742884-55742906 TTGCTGTTATTCAACTCACATGG - Intergenic
1082681383 11:56175894-56175916 TAGGTGTCATTCAAGAGACAGGG + Intergenic
1083952433 11:65964469-65964491 TAGGGGCTATTAAAGACACAGGG - Intronic
1084985545 11:72867958-72867980 TTGGTGTTTCTGTGGACACATGG - Exonic
1085142151 11:74155966-74155988 TTGGATTTTTTGTAGACACAGGG - Intronic
1085254114 11:75162762-75162784 TTGATGTTATGGAACACACTTGG - Exonic
1086700106 11:89892075-89892097 TTGCTGTTGTTGGAGAGACAGGG + Intergenic
1086706064 11:89952441-89952463 TTGCTGTTGTTGGAGAGACAGGG - Intergenic
1087290125 11:96312045-96312067 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1087542324 11:99535448-99535470 TTGGTGCTATAGAAAACAAATGG + Intronic
1087759274 11:102088442-102088464 TTGGTGTTGCTGGAGACATAAGG + Intergenic
1089075874 11:115737983-115738005 TTGTTGGTATTGCAGAAACATGG + Intergenic
1089512548 11:119009297-119009319 TTTGTGTTTTTGTAGAGACAGGG + Intronic
1090399395 11:126439376-126439398 TTGTTGTTGTTGTAGAGACAGGG + Intronic
1090970499 11:131638392-131638414 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1092801016 12:12166923-12166945 TTGGTATTTTTGTAGAGACAGGG - Intronic
1093007917 12:14070969-14070991 TTTGTTTCATTGAAGAAACAAGG + Intergenic
1093659721 12:21741070-21741092 TTGGTTTTTTTGAAGAGATAAGG - Intronic
1093848564 12:24006959-24006981 TTTGTGTTTTTGTAGACACGGGG - Intergenic
1093937614 12:25018376-25018398 TTTGTGTTTTTGTAGAGACAAGG + Intergenic
1094034976 12:26059310-26059332 TTGGTGTCATTGAGAAGACAAGG + Intronic
1095209908 12:39480964-39480986 TTGTTGATATTGAAAACATAAGG + Intergenic
1095547827 12:43392637-43392659 TTGGGGTTATTGATGACAGCAGG - Intronic
1096293993 12:50367971-50367993 TTTGTATTTTTGTAGACACAGGG - Intronic
1097363336 12:58682263-58682285 TTGATGTTATTGAGAAAACAAGG + Intronic
1098234786 12:68408070-68408092 TTGGAGCCATTGAAGACAGATGG - Intergenic
1100446207 12:94662390-94662412 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1102640893 12:114365654-114365676 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1103408124 12:120690180-120690202 TTTTTTTTATTGTAGACACAGGG + Intronic
1103582711 12:121927467-121927489 TTTGTATTTTTGTAGACACAGGG + Intronic
1103609755 12:122115878-122115900 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1104221959 12:126793635-126793657 TTTGTATTTTTGAAGAAACAGGG + Intergenic
1104511898 12:129387652-129387674 TTGGTGTTAGTGTTGGCACATGG - Intronic
1104538054 12:129637308-129637330 ATGGTGTTTTTGAATACACTGGG + Intronic
1105822542 13:24092498-24092520 ATGGTGATAATGAAGTCACATGG + Intronic
1106879762 13:34116395-34116417 TTGGTACAATTGAAGACACTAGG - Intergenic
1107098414 13:36561268-36561290 TTTTTGTTATGGATGACACATGG - Intergenic
1107131087 13:36896303-36896325 TTGGATTTATTGTAGAGACAAGG + Intronic
1108454448 13:50598867-50598889 TAGGTGTTTCAGAAGACACAAGG - Intronic
1108551282 13:51547616-51547638 TTTGTATTTTTGTAGACACAAGG - Intergenic
1110348822 13:74482010-74482032 TTGGTGTGGTTGAATTCACATGG - Intergenic
1110405494 13:75145683-75145705 TTGGTGCTAGAGATGACACATGG + Intergenic
1110442683 13:75542836-75542858 TTGCTGATTTTGAAGACAGATGG + Intronic
1110798703 13:79670161-79670183 TTGTTGTTTTTAAAGAGACAGGG - Intergenic
1111181519 13:84673156-84673178 TTTGTGTTATTGACTACAGAGGG - Intergenic
1111270777 13:85881357-85881379 ATGGTGTTATTGAAGGTTCATGG + Intergenic
1111645308 13:91024977-91024999 TTGGTTTTAGTTAAGAGACATGG + Intergenic
1112623173 13:101073208-101073230 TTGGAGTTGTTGAAGACCTAGGG + Intronic
1113455436 13:110445516-110445538 TTGTGGTTGTTGAAGACACTGGG - Intronic
1114332921 14:21656104-21656126 TTGGTTTTTTTGTAGAGACAGGG - Intergenic
1116716482 14:48432451-48432473 TTGTTGTTTTTTAAGAGACAGGG + Intergenic
1116786168 14:49291098-49291120 TATGAGTTATTGAGGACACAGGG - Intergenic
1117120445 14:52562584-52562606 TTGCTGTTTTTTAAGAGACAGGG - Intronic
1117428493 14:55626670-55626692 TTGGTGTTGTTGAAGGGTCAGGG + Intronic
1117990488 14:61428169-61428191 TTGGTATTTTTGTAGAGACAGGG + Intronic
1118784234 14:69032712-69032734 TTGGTTTTTTTGTAGAAACAGGG + Intergenic
1118960284 14:70523762-70523784 TTGATGTTTTTGAAGACAACAGG - Exonic
1119247830 14:73128226-73128248 TTGTTTTTTTTGTAGACACAAGG - Intergenic
1119492204 14:75045155-75045177 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1119663915 14:76470692-76470714 TTGCTGTTTTTAAAGAGACAAGG + Intronic
1119833517 14:77725743-77725765 TTTGTGTTATTTTAGAGACAGGG - Intronic
1120084963 14:80261955-80261977 TTGTTGTTGTTTTAGACACAGGG + Intronic
1120312852 14:82853554-82853576 TTTGTTTTATTGCAGACAGATGG - Intergenic
1120682469 14:87497017-87497039 TTGATGTTATTTAAGAGAGAAGG + Intergenic
1120918100 14:89727844-89727866 TTTCTGTCATTTAAGACACATGG + Intergenic
1121903698 14:97719855-97719877 ATGATGTTATAGAATACACATGG + Intergenic
1122195389 14:100081105-100081127 TTATTGTTATTGTAGAGACAGGG - Intronic
1122680554 14:103458285-103458307 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1123005211 14:105318153-105318175 TTGTTGTTGTTGCAGAGACAGGG + Intronic
1123450160 15:20354825-20354847 TTTGTTTTATTTAAGAGACAGGG - Intergenic
1123926260 15:25114721-25114743 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1124503005 15:30246458-30246480 TTGGTGATATTAAGAACACAGGG + Intergenic
1124740551 15:32292188-32292210 TTGGTGATATTAAGAACACAGGG - Intergenic
1124837834 15:33212666-33212688 TTGGTGGTATTGAATCCTCAAGG - Intergenic
1125013706 15:34908744-34908766 TTGGTGTTAAGGAAAACAAAAGG - Intronic
1125042495 15:35207218-35207240 TTGGTTTTTTTGTAGAGACAGGG + Intergenic
1125113156 15:36057478-36057500 TTGAAATTATTGAAGACACCAGG - Intergenic
1125624941 15:41100598-41100620 TTGGTGGTATTGTGGACATAAGG - Intronic
1126030574 15:44493619-44493641 TTGTTGTTTTTGTAGATACAGGG - Intronic
1126231861 15:46336555-46336577 TTGGTGATATTGCAGAGAAAAGG + Intergenic
1126945284 15:53812382-53812404 TGGGTTTTATTGAGGACACATGG - Intergenic
1127703860 15:61528065-61528087 TTGCAGTTATTGAATACAGAAGG + Intergenic
1127976659 15:64002439-64002461 TAGATGCTATGGAAGACACAGGG - Intronic
1128516829 15:68347488-68347510 TTGCTGTTATTCAAGACAGTGGG + Intronic
1129269096 15:74410148-74410170 CTGGTGTTCCTGAAGACCCAGGG - Exonic
1130086714 15:80783875-80783897 TTGGTGTTAGGAAACACACATGG + Intronic
1130705281 15:86227318-86227340 TTGGTGTTAATTATAACACAAGG + Intronic
1130817206 15:87449622-87449644 GTGATGTGATTTAAGACACAGGG + Intergenic
1131623790 15:94096638-94096660 TTGGTGTTTTTGTAGAGAAAGGG + Intergenic
1131691167 15:94829494-94829516 CTGGTGTTATAGAAGATATAGGG - Intergenic
1131816065 15:96222460-96222482 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1133885090 16:9819789-9819811 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1133902257 16:9988081-9988103 TTGGTGTTGTGGAAGCCATATGG - Intronic
1134132625 16:11659773-11659795 TTGGTGTTGTTGTTGAGACAGGG + Intergenic
1134755023 16:16659490-16659512 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1134991040 16:18699683-18699705 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1135122979 16:19782445-19782467 TTGGTATTTTTGTAGAGACAGGG - Intronic
1135696749 16:24594544-24594566 TTGGATTTTTTGAAGAGACAGGG + Intergenic
1136019863 16:27433292-27433314 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1136344941 16:29668973-29668995 TTTGTGTTTTTGTAGAGACAGGG - Exonic
1137276099 16:46934677-46934699 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1137799456 16:51248722-51248744 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1138418100 16:56882768-56882790 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1138812736 16:60169909-60169931 TTGGTATTTTAGTAGACACAGGG + Intergenic
1139417138 16:66822037-66822059 TTGTAGTTTTTGTAGACACAAGG + Intronic
1139829301 16:69783771-69783793 TTGTTGTTGTTGTAGAAACAAGG - Intronic
1140352144 16:74272416-74272438 TTGTTGTTATTGTTGAGACAGGG - Intergenic
1141372221 16:83498513-83498535 ATGGTGATATGTAAGACACATGG - Intronic
1141761158 16:86029520-86029542 TTGGTGGAATTGAAAAAACACGG + Intergenic
1142021842 16:87788210-87788232 TTGGATTTTTTGAAGAGACAGGG - Intergenic
1142197933 16:88747342-88747364 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1143912745 17:10265389-10265411 TTGGTGTTAAAGAGGACACTGGG - Intergenic
1144055205 17:11534517-11534539 TTAGTGTGTTAGAAGACACAAGG + Intronic
1144085595 17:11805723-11805745 TTTGTGTTTTTGTGGACACAGGG + Intronic
1144288550 17:13803675-13803697 TTGGTGTTATTAAAGAAGGAAGG + Intergenic
1145222817 17:21103363-21103385 TTGTTTTTTTTTAAGACACAGGG - Intergenic
1147200093 17:38795432-38795454 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1147228271 17:38997884-38997906 TTTGTGTTTTTGCAGACACTAGG + Intergenic
1147534550 17:41310976-41310998 TTTGTGTTGATGAAAACACATGG - Intergenic
1148010003 17:44470843-44470865 TTGGTGTTTTTTAGGATACACGG - Intronic
1148064306 17:44857600-44857622 TTGGTGTCATAGAAAACACTGGG - Intronic
1148527895 17:48359776-48359798 TTGTTTTTTTTGTAGACACAGGG + Intronic
1150551646 17:66216186-66216208 TTAGTATTATTGTAGACACATGG - Intronic
1150551852 17:66217960-66217982 TTAGTATTATTATAGACACATGG - Intronic
1152203315 17:78959747-78959769 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1152220532 17:79062472-79062494 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
1153097805 18:1428027-1428049 TTGGTGTCATTCAAGACAAAGGG + Intergenic
1153335051 18:3914913-3914935 TTTGTGTTTTTGTAGAGACAGGG + Intronic
1153744178 18:8160465-8160487 TTGTTGTTGTTGTAGAGACAGGG + Intronic
1153766980 18:8384284-8384306 TTTGTATTTTTGGAGACACAGGG - Intronic
1153909214 18:9691837-9691859 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1154227095 18:12515340-12515362 TTGGTTTTTTTGGAGAGACAGGG - Intronic
1154244330 18:12682359-12682381 TTTGTGTTTTTGTAGAGACAAGG + Intronic
1155122559 18:22837808-22837830 TTCGTCTTATTGTACACACAAGG - Intronic
1155452633 18:25978737-25978759 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1155466326 18:26139632-26139654 TTAGTCTTATTGAACACAGAAGG - Intronic
1155815396 18:30301711-30301733 TTGGTTTTATGTAAGAGACAGGG - Intergenic
1155959352 18:31980900-31980922 TTTGTGTTTTTGTAGAGACAAGG + Intergenic
1155968123 18:32055122-32055144 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1158484425 18:57852620-57852642 TTTGTATTATTGTAGACACGGGG - Intergenic
1158596894 18:58824443-58824465 TTGGATTTTTTGAAGAGACAGGG - Intergenic
1158851546 18:61499927-61499949 TTGGTGTTTTAGTAGAGACAGGG - Intronic
1160183965 18:76660463-76660485 TTTGTGTTCTTGTAGACAGATGG - Intergenic
1160266930 18:77346134-77346156 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1161184955 19:2911356-2911378 TTGGTATTTTTGTAGAGACAGGG - Intronic
1162229315 19:9252655-9252677 TTGGTTTTATTGAAATCACCTGG + Intergenic
1162597140 19:11638397-11638419 TTGGTATTTTTGTAGAGACAAGG - Intergenic
1163078146 19:14914941-14914963 TGGCTGAAATTGAAGACACAAGG - Intergenic
1163540043 19:17903099-17903121 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
1163838806 19:19593101-19593123 TTGTTGTTGTTGTAGAGACAGGG + Intronic
1163853675 19:19682391-19682413 TTGGTATTTTTGTAGAAACAGGG + Exonic
1163911873 19:20202918-20202940 TTGGTATTTTTGTAGAGACAGGG - Intergenic
1166270065 19:41708186-41708208 TTGGTGGTACTGGAGACAGAGGG + Intronic
1166392546 19:42417560-42417582 TTTGTGTTTTTTAAGAGACAGGG + Intronic
1166559662 19:43723918-43723940 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1166640919 19:44494664-44494686 TTGTTGTTTTTTAAGAGACAGGG - Intronic
1167170780 19:47830300-47830322 TTGGGGTTTTTTAAGAGACAAGG - Intronic
1167832760 19:52039657-52039679 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1168106430 19:54168382-54168404 TTCGTGTCATTGAAGGCACTGGG + Intronic
1168656724 19:58134761-58134783 TTTGTGTTTTTGTAGAGACATGG - Intronic
925829889 2:7883572-7883594 TTTCTGTTATTTAAGCCACATGG + Intergenic
926115836 2:10212841-10212863 TTTGTATTTTTGTAGACACAGGG - Intergenic
927738710 2:25547019-25547041 TTGTTGTTGTTGTAGAGACAGGG + Intronic
929885382 2:45873367-45873389 TGGGTGTTGTTGATGTCACATGG + Intronic
930172207 2:48263466-48263488 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
931533218 2:63241024-63241046 TTGGTGTTATTGAATAAGTATGG - Intronic
932326660 2:70867000-70867022 TTGTTGTTGTTGTAGAGACAGGG - Intergenic
933518134 2:83331964-83331986 TTGGTATTTTTGTAGAGACAGGG + Intergenic
933985993 2:87592710-87592732 TTGATGGTAGTGAAGACCCAAGG + Intergenic
934581025 2:95438388-95438410 TTGCTGTTGTTGGAGAGACAGGG + Intergenic
934598425 2:95638326-95638348 TTGCTGTTGTTGGAGAGACAGGG - Intergenic
934943899 2:98522113-98522135 TTTGTATTTTTGTAGACACAGGG - Intronic
935156090 2:100484867-100484889 TTGTTGTTATTGAGGACTGAGGG + Intergenic
935466594 2:103405648-103405670 TTGTTGTTTTTTAAGAGACAGGG - Intergenic
935537469 2:104310823-104310845 TTGTTGTTATTCAAGGAACAGGG - Intergenic
935587103 2:104811060-104811082 TTGTTGTTGTTGTAGATACAGGG - Intergenic
936024867 2:109023628-109023650 TTGATGTTTTTGTAGAGACAGGG - Intergenic
936100799 2:109577419-109577441 TTTGTGTTTTTGCAGAGACAGGG - Intronic
936307843 2:111358094-111358116 TTGATGGTAGTGAAGACCCAAGG - Intergenic
936902139 2:117493469-117493491 TTGCTGGCTTTGAAGACACAGGG + Intergenic
938908060 2:135858183-135858205 TTGTTGTTTTTTAAGAGACAGGG - Intronic
939021827 2:136966387-136966409 TTTGTGTTTTTGTAGAGACAGGG + Intronic
939204606 2:139084389-139084411 TTGGTATTTTTGTAGACTCATGG + Intergenic
940859303 2:158755737-158755759 TTTCTTTTATTGAAGAAACAAGG - Intergenic
941345854 2:164368382-164368404 TTGGTGAGAATGAAGACAAAAGG - Intergenic
941820156 2:169836426-169836448 TTGGTGTTAATGAGAACACATGG + Intronic
942366046 2:175228908-175228930 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
942597259 2:177602996-177603018 TTGATTCTATTGGAGACACAGGG - Intergenic
943157458 2:184201465-184201487 TTGTTGTTATTTTAGAGACAGGG - Intergenic
943492513 2:188573455-188573477 TTTGCTTTATTGCAGACACATGG - Intronic
943799371 2:192038656-192038678 TAGGTGTTTTTGTAGATACAGGG + Intronic
943941214 2:194000560-194000582 ATGATATTAGTGAAGACACAAGG + Intergenic
944576180 2:201093048-201093070 TTTGTGTTTTTGCAGAGACAGGG - Intergenic
944634617 2:201662969-201662991 TTGTTATTATTGATGACATATGG - Intronic
944702764 2:202260485-202260507 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
944772530 2:202928900-202928922 TTTGTGTTTTTGTAGAGACAGGG + Intronic
945092896 2:206192517-206192539 TTGTTGTTGTTTAAGAGACAGGG - Intronic
946047371 2:216832599-216832621 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
946071965 2:217041769-217041791 TTGGTTTTATTGGAAACACATGG - Intergenic
946654404 2:221930389-221930411 TTGGTGTCATTGGCCACACAAGG + Intergenic
947786630 2:232828157-232828179 TTTTTGTTTTTGAAGACATAGGG + Intronic
948012928 2:234664472-234664494 TTGGTGTTCTTTGAGAGACATGG - Intergenic
1168872611 20:1143916-1143938 TTAGTATTTTTGAAGAGACACGG - Intronic
1169018905 20:2313991-2314013 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1169199673 20:3702411-3702433 TTTGTGTTTTTGTAGAGACAGGG - Intronic
1169305988 20:4490805-4490827 TTGCTGTGATAGAGGACACAGGG + Intergenic
1169352784 20:4883022-4883044 TTTGTGTTAATGAAGTCACAGGG - Intronic
1170632837 20:18080053-18080075 TTTGTATTTTTGTAGACACAGGG - Intergenic
1171568355 20:26218666-26218688 TGTGTGTTGTTGAACACACATGG - Intergenic
1172071244 20:32258892-32258914 TTGGTATTTTTGTAGAGACAGGG - Intergenic
1172528495 20:35615707-35615729 TTGTTGTTGTTTAAGAGACAGGG - Intergenic
1172737587 20:37139375-37139397 ACAGTGTTATTGAAGACCCAGGG - Intronic
1173886983 20:46468455-46468477 TTGGTATTTTTGTAGAGACAGGG + Intergenic
1174633820 20:51981480-51981502 TTGTTGTCATTGTAGAGACAGGG - Intergenic
1174963503 20:55184898-55184920 TTTGTATTTTTGAAGAGACAGGG + Intergenic
1175458074 20:59130172-59130194 TTGCTGTTATTAAAGAGACAGGG + Intergenic
1177224931 21:18242247-18242269 AAGGTGTCATAGAAGACACATGG - Intronic
1177828147 21:26106769-26106791 TTGAGGTCATTGAAGACAAAAGG - Intronic
1178103725 21:29297477-29297499 TTGAAGTTCTTGCAGACACATGG - Intronic
1178354195 21:31897070-31897092 TTTGTATTTTTGTAGACACAGGG - Intronic
1178952749 21:36998598-36998620 TTGTTGTTATTTTAGAGACAGGG + Intergenic
1179323423 21:40315584-40315606 TTGGAATTATAGAAAACACAGGG - Intronic
1180030975 21:45207465-45207487 TGGGTGTTACTGGAGACAAAAGG + Intronic
1180578829 22:16809922-16809944 TTGGTATTTTTGTAGAGACAGGG + Intronic
1181775875 22:25159917-25159939 CTGGTTTTATTGAAGCCCCAAGG + Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
1182408746 22:30162872-30162894 TTGGTATTTTTGTAGAGACAGGG + Intronic
1182760878 22:32721397-32721419 GGGGTTTTATTGAAGACACCTGG - Intronic
1184487529 22:44789671-44789693 TTGGTTTTTTTGTAGAGACAGGG + Intronic
1184743873 22:46444903-46444925 TTCCTGTTATTAAAGACACCAGG + Intronic
949481621 3:4499654-4499676 TTGTTGTTATCGAAGAAACTGGG + Intronic
949587865 3:5460508-5460530 TTTGTATTATTGTATACACACGG - Intergenic
951678152 3:25265642-25265664 TTTGTATTTTTGTAGACACAGGG + Intronic
953615219 3:44484007-44484029 TTTGTATTTTTGTAGACACAAGG + Intergenic
953896142 3:46803955-46803977 ATTGTGTTATGGAAGGCACATGG - Intronic
955232997 3:57115407-57115429 CTGGTGTCTTTGATGACACATGG - Intronic
955275212 3:57540755-57540777 TTTGTATTTTTGAAGAGACATGG - Intronic
955832894 3:63023680-63023702 TCGTTGTTGTTGAAGAGACAGGG - Intergenic
956343302 3:68249940-68249962 TTGGTGCTATTCTAGACACGTGG - Intronic
956763213 3:72461806-72461828 ATGGTGTCATTGAAGCCACAGGG + Intergenic
956854488 3:73262533-73262555 TTTGTGTTTTTGAAGAGACAGGG + Intergenic
957110493 3:75949679-75949701 TGTGTGTTGTTGAACACACATGG + Intronic
957697439 3:83658911-83658933 TTGCTGTTGTTGATGAGACAGGG + Intergenic
958119697 3:89269446-89269468 TTATTATTATTGTAGACACAGGG + Intronic
958526970 3:95274236-95274258 GTGGTGTGATAGAACACACAAGG + Intergenic
958791043 3:98651592-98651614 CTGGTGTAATTGAAGACAGCAGG - Intergenic
959984437 3:112557085-112557107 TTGTTTTTGGTGAAGACACATGG - Intronic
960973962 3:123157823-123157845 ATGGTGTTATTGAAGGGGCAAGG + Intronic
961567074 3:127771526-127771548 TTTGTGTTTTTTAAGAGACAGGG + Intronic
962499660 3:135977870-135977892 TTTGTGTTTTTGTAGAGACAGGG + Intronic
963338577 3:144005809-144005831 TTGGTCTTGTTGAAGACAGGTGG - Intronic
963438555 3:145306076-145306098 TTGCTGGTTTTGAAGATACAGGG - Intergenic
963677264 3:148327984-148328006 TTGTTGTTGTTGAAGAAACTAGG + Intergenic
963949892 3:151187788-151187810 TTTGTGTTTTTGGAGAAACATGG - Intronic
964169215 3:153748594-153748616 TTGGAGGTATTTAAGTCACAAGG + Intergenic
965179113 3:165378486-165378508 TTGTTGTTGTTGGAGAGACAGGG - Intergenic
966053223 3:175648203-175648225 CTTGTGTTATTGAGAACACATGG + Intronic
966185841 3:177226323-177226345 TTGGTGTTCTTGAGTACATATGG + Intergenic
966258849 3:177951055-177951077 TTGTTGTTGTTGAAGCCACCCGG + Intergenic
966401392 3:179551052-179551074 TTGTTGTTGTTGTAGAGACAGGG - Intergenic
966964665 3:184978570-184978592 TTTGTGTTTTTGTAGAAACAGGG + Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
969936266 4:10684966-10684988 AGGGTGTTTTTAAAGACACACGG + Intergenic
971407968 4:26339845-26339867 TTTGTATTTTTGTAGACACAGGG - Intronic
971908772 4:32765886-32765908 ATGGTGTCATTGAATAGACAAGG - Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
974622480 4:64378170-64378192 GAGCTGTTTTTGAAGACACAAGG + Intronic
975198516 4:71555860-71555882 TTGGTTTTTTTAAAGAGACAGGG - Intronic
976628877 4:87217516-87217538 TTTGTTTTTTTGTAGACACAGGG + Intronic
977004735 4:91550722-91550744 TTGGTGTTAATGAATGCACAGGG + Intronic
977107603 4:92907849-92907871 TTTGTGTTTTTGTAGAGACAGGG - Intronic
977128077 4:93195701-93195723 TTGGTGTTATTGCAAATTCATGG - Intronic
978260148 4:106746311-106746333 TTGGTGTTTCAGAAGACATATGG + Intergenic
978773748 4:112485134-112485156 TTTGTGTTTTTGTAGAGACATGG - Intergenic
978806338 4:112804780-112804802 TTGTTGTTGTTGTAGAGACAGGG - Intergenic
979896130 4:126159726-126159748 TTGATGTCATTCAAGATACAAGG - Intergenic
980593367 4:134921106-134921128 TTAGTGTGATTGCAGACACTAGG + Intergenic
980910929 4:138993616-138993638 TTGTTGTTTTTGTAGAGACAAGG + Intergenic
981976938 4:150742318-150742340 TTGGTGGTGTTGTAGAGACAGGG + Intronic
982425068 4:155248478-155248500 TTGGGGTTAATAAAGCCACAGGG + Intergenic
983458747 4:167999992-168000014 TTAGTGTAATGGCAGACACAAGG - Intergenic
983733157 4:171023352-171023374 TAGGTTTTAATGAAGGCACAAGG + Intergenic
984204798 4:176773687-176773709 TTGTTGTTTTTTAAGAGACAGGG + Intronic
984705968 4:182847444-182847466 TTGGTGGTGTTGGAGACACTTGG + Intergenic
984940841 4:184930891-184930913 TTTGTGTTTTTGTAGAAACAGGG + Intergenic
984979840 4:185269746-185269768 TTGTTGTTTTTTAAGAGACAAGG + Intronic
985768105 5:1791747-1791769 TTGGTATTTTTGTAGAGACAGGG + Intergenic
987990541 5:25205689-25205711 TTTGTGTTGTTGAAGCCACCTGG + Intergenic
988584838 5:32499401-32499423 TGGGGTTTATTGAAGTCACAGGG - Intergenic
988898835 5:35709075-35709097 TAGGAGTTTTTGAAGCCACATGG - Exonic
989578923 5:43013918-43013940 AAGGGGTTATTGAAGACATATGG - Intergenic
989755320 5:44945727-44945749 TTGGCATTACTGAAGACAGATGG + Intergenic
991521251 5:67499567-67499589 TTGTTGTTATTGCAGAAATATGG - Intergenic
992684856 5:79189341-79189363 TTGTTGTTCTTGTAGAGACAGGG + Intronic
995286526 5:110395210-110395232 TTTGTTTTATAGAAGAGACAGGG + Intronic
995530987 5:113091707-113091729 TTGTTGTTGTTGTAGAGACAGGG - Intronic
996494184 5:124134227-124134249 AAGGTGTTATGGAAGACAAAAGG + Intergenic
997076499 5:130684993-130685015 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
997487279 5:134242060-134242082 TTGGTGTTGTTGAAGATAATGGG + Intergenic
998748644 5:145291559-145291581 TTGCTGTTATTTAAGCCACTTGG + Intergenic
998838204 5:146225132-146225154 TTGTTGTTGTTAAAGAGACAGGG + Intronic
999138242 5:149338285-149338307 TTGTAGTTTTTGTAGACACAGGG - Intronic
999344436 5:150803448-150803470 TCAGTGTCAATGAAGACACAGGG + Intergenic
1000302723 5:159970809-159970831 TTGTTGTTTTTGGAGAGACAGGG + Intronic
1001391038 5:171379532-171379554 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1003585248 6:7382735-7382757 TTTGTGTTTTTGTAGAAACAGGG - Intronic
1004122813 6:12841262-12841284 TTGGTCTAATGGAAGAAACAGGG - Intronic
1005270049 6:24153856-24153878 TTGGTGATGTTGTAGAGACAGGG - Intronic
1005372054 6:25143782-25143804 TTTTTGTTTTTGTAGACACAGGG - Intergenic
1006190921 6:32208429-32208451 TGGCTGTTATTGAAAACACAAGG + Intronic
1007013364 6:38438980-38439002 TTGCTGTTCTTGAACACACAAGG - Intronic
1007545882 6:42694198-42694220 TTGGTTTTTTTAAAGAGACAGGG + Intergenic
1007688762 6:43684099-43684121 TTGTTGTTGTTTAAGAGACAAGG - Intronic
1008086550 6:47251390-47251412 TTGGTATTATAGAAGAGATAAGG + Intronic
1008213465 6:48755299-48755321 TTAGTATTATGGAACACACATGG - Intergenic
1008553145 6:52652380-52652402 TTGGTGTTATTTAAATCAGATGG - Intergenic
1008837047 6:55846350-55846372 TTGGTGTTATTGAAGACACATGG + Intronic
1008924095 6:56874106-56874128 TTTGTGTTTTTTAAGAGACAGGG - Intronic
1010443760 6:75928369-75928391 TTTGTGTTTTTGTAGAGACAGGG + Intronic
1012509214 6:99983141-99983163 TTGGTATTTTTGTAGAGACAGGG + Intronic
1012847676 6:104411226-104411248 TTGGTATTTTAGTAGACACAGGG + Intergenic
1017544966 6:155440632-155440654 TTGTTGTTGTTTTAGACACAGGG - Intronic
1018328535 6:162701962-162701984 TTGGTTTAATAGAAGATACAGGG - Intronic
1018575478 6:165255445-165255467 TTGGAGATATGGAAGAAACATGG + Intergenic
1021154346 7:17191853-17191875 TTGGTGTTATTGAGATCTCAAGG - Intergenic
1021585793 7:22206527-22206549 TTGGTATTTTTGTAGAGACAAGG - Intronic
1021676649 7:23086860-23086882 TTGTTGTTTTTGTAGAGACAGGG - Intergenic
1022486462 7:30782527-30782549 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1023501509 7:40854927-40854949 TTTGTTTTTTTTAAGACACAGGG - Intronic
1025088599 7:56043665-56043687 TTTGTTTTATTGTAGAGACAGGG - Intronic
1025952641 7:66157621-66157643 TTGGTATTTTTGTAGAGACAGGG - Intergenic
1026206602 7:68263146-68263168 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
1027142234 7:75666638-75666660 CGGGTGTTACTGAAGTCACAGGG + Intronic
1027156040 7:75768754-75768776 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1028322107 7:89473048-89473070 TTGGGATAATTGTAGACACATGG - Intergenic
1029256852 7:99275168-99275190 TTTTTGTTTTTGAAGAGACAGGG + Intergenic
1030498624 7:110331321-110331343 TTAATGTTATTTAAGACATATGG - Intergenic
1030898214 7:115088030-115088052 TATGTGCTTTTGAAGACACATGG + Intergenic
1031894846 7:127337067-127337089 TTGTTGTTATTGTTGAGACAGGG + Intergenic
1033571589 7:142634263-142634285 GAGGTGTTATTGAAGATATACGG + Intergenic
1033912651 7:146284303-146284325 TTGGTGTTATTTTAGCCACCAGG - Intronic
1033949134 7:146761848-146761870 TCCGTGTTATTGAAGACATGAGG + Intronic
1035186021 7:157126240-157126262 AAGGTGGTATTCAAGACACAGGG - Intergenic
1035897388 8:3418742-3418764 TTGGTGATCATGCAGACACACGG + Intronic
1036697884 8:10990596-10990618 TTGCTGTTATTGCTGAGACAGGG + Intronic
1037105289 8:15099212-15099234 GTCTTATTATTGAAGACACAAGG - Intronic
1038177300 8:25192682-25192704 TTGTTGTTTTCGTAGACACAGGG + Intronic
1038178658 8:25205424-25205446 TTTCTGTTATTTAAGCCACATGG + Intronic
1040095530 8:43438874-43438896 TTTGTATTATTGTAGAGACAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041475151 8:58256812-58256834 TTGGTGTCTTTTAAGACAAAAGG + Intergenic
1042492310 8:69413660-69413682 TTGATTTTTTTGTAGACACAAGG - Intergenic
1043637350 8:82402901-82402923 TTGCTTTTATTGAAGATAGAAGG + Intergenic
1045056765 8:98375065-98375087 TTTGTTTTTTTGTAGACACAGGG - Intergenic
1046039721 8:108887770-108887792 TTGCAATTATTGTAGACACATGG + Intergenic
1046396582 8:113648562-113648584 TTGGTGTTACTGAAGCACCAGGG + Intergenic
1046828058 8:118713718-118713740 TTGGTGTTACAGCAGACACACGG + Intergenic
1047806287 8:128364199-128364221 TTGGTGTTGTTGAAGATACTGGG + Intergenic
1048529224 8:135232593-135232615 ATGGTGTTATGGAAGCAACAAGG + Intergenic
1049919201 9:347329-347351 TTGTTGTTGTTGTAGAGACAGGG - Intronic
1050213379 9:3291027-3291049 TTCTTATTTTTGAAGACACAGGG + Intronic
1052376659 9:27725351-27725373 TTTGTGGTATTGAGAACACAAGG + Intergenic
1052587203 9:30443954-30443976 TTGTTTTTATAGAAGACACTAGG - Intergenic
1053132844 9:35628005-35628027 TTGTTGTTGTTGTAGAGACAAGG + Intronic
1053247001 9:36542803-36542825 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1053320633 9:37095436-37095458 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1054466115 9:65495647-65495669 TTGGGACTATTGGAGACACACGG - Intergenic
1055188943 9:73493817-73493839 ATGGTGTTATTCAAGATATATGG + Intergenic
1055607757 9:77988699-77988721 TTGTTATTATAGAAGACTCAAGG + Intronic
1056268397 9:84922767-84922789 TTGGTGCTGTGGAAGACTCAAGG - Intronic
1056288996 9:85122807-85122829 TTTGTGTTTTTGTAGAGACAGGG - Intergenic
1057493659 9:95542883-95542905 GTGGAGTTATTTAAGACAAATGG + Intergenic
1057604038 9:96485923-96485945 TAGGTGTCATTTAAGATACAGGG + Intronic
1058620988 9:106882857-106882879 TTGGTGGTATGGAAGCCTCAAGG + Intronic
1058717279 9:107733926-107733948 TTGGGGTTTTGGAATACACATGG + Intergenic
1058948658 9:109882561-109882583 TAGGTGTTATTATAGACAGAAGG + Intronic
1059861688 9:118470703-118470725 TTTGTGTTATAGAAAACCCAGGG + Intergenic
1061081865 9:128375730-128375752 TTGTAGTTTTTGTAGACACAAGG + Intronic
1061652798 9:132064719-132064741 TGGGTGATATTTAAGACACCAGG + Intronic
1185828889 X:3279712-3279734 TTAGTTTTTTTGTAGACACAGGG + Intronic
1188043289 X:25395740-25395762 TTGGTGTCATTGAAGATACCAGG - Intergenic
1188048437 X:25454831-25454853 TTTGTGTTTTTGTAGAGACAGGG + Intergenic
1188150169 X:26664399-26664421 TTGTTGTTTTTTAAGAGACAGGG + Intergenic
1188763446 X:34059910-34059932 TTGATGTTTTTGTAGAGACAAGG + Intergenic
1190182957 X:48208941-48208963 TTGAGGAGATTGAAGACACAGGG - Intronic
1191176969 X:57514772-57514794 TTGGTGTCATTGCAGTGACATGG + Intergenic
1192730230 X:73795685-73795707 TTTGTGTTTTTGTAGAGACAAGG - Intergenic
1192778719 X:74272098-74272120 TTGGTTATATTGAAGCAACAGGG + Intergenic
1193053853 X:77128773-77128795 TTGGTGGAATAGTAGACACATGG + Intergenic
1195267943 X:103201828-103201850 TTGTTGTTGTTGTTGACACAGGG + Intergenic
1195405782 X:104511665-104511687 TTTGTGTTTTTTAAGAGACAAGG - Intergenic
1195590247 X:106616345-106616367 TTGGTGTTTTTTAAGACACTTGG + Intronic
1195822306 X:108958867-108958889 TTGGTTTTAATGATGACAGAAGG + Intergenic
1199390951 X:147278214-147278236 TATGTGTTATTGGGGACACAAGG - Intergenic
1200246140 X:154526934-154526956 TTTGTATTATTGTAGAAACAGGG + Intergenic
1200387649 X:155908997-155909019 TTGGTTTTTTTGTAGAGACAAGG + Intronic
1201288352 Y:12398268-12398290 TTGTTGTTGTTGTAGAGACAGGG + Intergenic
1201386059 Y:13440673-13440695 TTGGGGTCATAGCAGACACAGGG - Intronic
1201562883 Y:15336279-15336301 TTGTTATTATTGTAGAGACATGG + Intergenic