ID: 1008842211

View in Genome Browser
Species Human (GRCh38)
Location 6:55916393-55916415
Sequence GCATGCTCAAAAATCCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008842211_1008842213 -2 Left 1008842211 6:55916393-55916415 CCTACCAGGATTTTTGAGCATGC No data
Right 1008842213 6:55916414-55916436 GCATAATCAAATTGTTTCAGAGG No data
1008842211_1008842214 13 Left 1008842211 6:55916393-55916415 CCTACCAGGATTTTTGAGCATGC No data
Right 1008842214 6:55916429-55916451 TTCAGAGGAAAAAGAAAAAATGG No data
1008842211_1008842216 29 Left 1008842211 6:55916393-55916415 CCTACCAGGATTTTTGAGCATGC No data
Right 1008842216 6:55916445-55916467 AAAATGGCACATGGCTACTGTGG No data
1008842211_1008842215 20 Left 1008842211 6:55916393-55916415 CCTACCAGGATTTTTGAGCATGC No data
Right 1008842215 6:55916436-55916458 GAAAAAGAAAAAATGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008842211 Original CRISPR GCATGCTCAAAAATCCTGGT AGG (reversed) Intergenic
No off target data available for this crispr