ID: 1008842992

View in Genome Browser
Species Human (GRCh38)
Location 6:55927224-55927246
Sequence CTCCCGAAGAGGGAAGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008842989_1008842992 -4 Left 1008842989 6:55927205-55927227 CCTCTTGCAGGGACACTTGCTCC No data
Right 1008842992 6:55927224-55927246 CTCCCGAAGAGGGAAGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008842992 Original CRISPR CTCCCGAAGAGGGAAGTGAG AGG Intergenic
No off target data available for this crispr