ID: 1008847292

View in Genome Browser
Species Human (GRCh38)
Location 6:55983425-55983447
Sequence AGGATGGGCGTGGGTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008847292_1008847302 27 Left 1008847292 6:55983425-55983447 CCCTCTCTACCCACGCCCATCCT No data
Right 1008847302 6:55983475-55983497 ATTCCATCCATTTAATACTCTGG No data
1008847292_1008847303 28 Left 1008847292 6:55983425-55983447 CCCTCTCTACCCACGCCCATCCT No data
Right 1008847303 6:55983476-55983498 TTCCATCCATTTAATACTCTGGG No data
1008847292_1008847304 29 Left 1008847292 6:55983425-55983447 CCCTCTCTACCCACGCCCATCCT No data
Right 1008847304 6:55983477-55983499 TCCATCCATTTAATACTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008847292 Original CRISPR AGGATGGGCGTGGGTAGAGA GGG (reversed) Intergenic
No off target data available for this crispr