ID: 1008848215

View in Genome Browser
Species Human (GRCh38)
Location 6:55993793-55993815
Sequence TTTTAGCCACAGCTGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008848203_1008848215 30 Left 1008848203 6:55993740-55993762 CCATGTAGTGTTTGCACCCCCTG No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848208_1008848215 4 Left 1008848208 6:55993766-55993788 CCACAGCCTGAGCTCTATCTTGT No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848205_1008848215 13 Left 1008848205 6:55993757-55993779 CCCCTGAAGCCACAGCCTGAGCT 0: 216
1: 465
2: 828
3: 1251
4: 1613
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848206_1008848215 12 Left 1008848206 6:55993758-55993780 CCCTGAAGCCACAGCCTGAGCTC No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848209_1008848215 -2 Left 1008848209 6:55993772-55993794 CCTGAGCTCTATCTTGTCCCCTT No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848207_1008848215 11 Left 1008848207 6:55993759-55993781 CCTGAAGCCACAGCCTGAGCTCT No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data
1008848204_1008848215 14 Left 1008848204 6:55993756-55993778 CCCCCTGAAGCCACAGCCTGAGC No data
Right 1008848215 6:55993793-55993815 TTTTAGCCACAGCTGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008848215 Original CRISPR TTTTAGCCACAGCTGGAGCT GGG Intergenic
No off target data available for this crispr