ID: 1008851735

View in Genome Browser
Species Human (GRCh38)
Location 6:56030435-56030457
Sequence CTTTATTAGCAGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008851732_1008851735 -6 Left 1008851732 6:56030418-56030440 CCCAGTCTCAGGTATGTCTTTAT 0: 2779
1: 6067
2: 10377
3: 11010
4: 9585
Right 1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG No data
1008851730_1008851735 7 Left 1008851730 6:56030405-56030427 CCTTTATAAATTACCCAGTCTCA 0: 1925
1: 3198
2: 4070
3: 3254
4: 1860
Right 1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG No data
1008851729_1008851735 14 Left 1008851729 6:56030398-56030420 CCTCTTTCCTTTATAAATTACCC 0: 3442
1: 8020
2: 8919
3: 8212
4: 5079
Right 1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG No data
1008851733_1008851735 -7 Left 1008851733 6:56030419-56030441 CCAGTCTCAGGTATGTCTTTATT 0: 1097
1: 3639
2: 7030
3: 10378
4: 10910
Right 1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG No data
1008851728_1008851735 22 Left 1008851728 6:56030390-56030412 CCTTTAAACCTCTTTCCTTTATA 0: 699
1: 1035
2: 1698
3: 1828
4: 1728
Right 1008851735 6:56030435-56030457 CTTTATTAGCAGCATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008851735 Original CRISPR CTTTATTAGCAGCATGAGGA TGG Intergenic
No off target data available for this crispr