ID: 1008857624

View in Genome Browser
Species Human (GRCh38)
Location 6:56110950-56110972
Sequence GTCTACACCCCACCTTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008857623_1008857624 -2 Left 1008857623 6:56110929-56110951 CCTCTAAGATTTGGAGCTTAAGT 0: 1
1: 0
2: 1
3: 16
4: 173
Right 1008857624 6:56110950-56110972 GTCTACACCCCACCTTGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 67
1008857622_1008857624 -1 Left 1008857622 6:56110928-56110950 CCCTCTAAGATTTGGAGCTTAAG 0: 1
1: 0
2: 1
3: 11
4: 134
Right 1008857624 6:56110950-56110972 GTCTACACCCCACCTTGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008857624 Original CRISPR GTCTACACCCCACCTTGAGT AGG Intronic
900340559 1:2186729-2186751 GCCGGGACCCCACCTTGAGTGGG + Intronic
902634984 1:17729183-17729205 GTCCATACCCCTCCTTGAGCAGG + Intergenic
902811463 1:18890243-18890265 GTCAAAACCCCACCTTGGGCTGG + Intronic
903137275 1:21317731-21317753 GTTAGGACCCCACCTTGAGTTGG - Intronic
906204993 1:43981866-43981888 ATCTACACCCCATCTTGAGGCGG + Exonic
908785604 1:67731883-67731905 TTCTCCACCCCAACTTGACTTGG + Intronic
913086330 1:115440563-115440585 GTTAAAACCCCAGCTTGAGTTGG - Intergenic
917804370 1:178599875-178599897 GTCTCCTCCCCACCTTATGTGGG - Intergenic
1072708345 10:97698476-97698498 GTGTTCCCCACACCTTGAGTAGG - Intergenic
1077009021 11:371891-371913 TTCTACACCCCACCTCTGGTGGG - Intronic
1077702043 11:4451440-4451462 TTCTACACCCCACCTGAAATAGG - Intergenic
1084506219 11:69570096-69570118 GTCTACTCCTCCCCTTGAGTAGG + Intergenic
1100820672 12:98426705-98426727 GTCTATGTCCCACCTGGAGTTGG - Intergenic
1106610400 13:31273910-31273932 GGTCACACCCCACCTTGGGTGGG + Intronic
1110791286 13:79589601-79589623 GTCTCCACCCTACCTTAATTAGG - Intergenic
1120499162 14:85272513-85272535 CTCTACAACCCACATTGATTCGG + Intergenic
1121746746 14:96301777-96301799 GTCTACATCACACCATGAGTAGG + Intronic
1124066604 15:26349922-26349944 GTCTTCAATCCATCTTGAGTTGG - Intergenic
1125351417 15:38771174-38771196 GTCTACACCACCCCTTCTGTGGG + Intergenic
1129235990 15:74224106-74224128 GTCTGCACCCCTCCCTGCGTGGG - Intergenic
1132917988 16:2364464-2364486 ATATACACCCCACCTTGAATGGG - Intergenic
1136989154 16:35141462-35141484 GTCTGCACCCCTCCTTCAGAAGG - Intergenic
1139219876 16:65170377-65170399 GTCTTCACGCCATCATGAGTAGG + Intergenic
1142359624 16:89619950-89619972 GTCTCCACCCTGCCTTGGGTGGG + Intronic
1162910352 19:13844499-13844521 TTCTGCGCCCCACCCTGAGTTGG - Intergenic
1163748740 19:19063278-19063300 GTCTTCACACCACCTCGAGATGG + Intergenic
1164010663 19:21200887-21200909 GTGTACACCTCACCTGGAGGAGG + Intergenic
927647616 2:24887811-24887833 GTCTCCAACCCACCCTGAGATGG - Intronic
937644244 2:124248547-124248569 GTCTTCACCCCAGCTTCAGCAGG + Intronic
940044737 2:149397489-149397511 GAATACACTCTACCTTGAGTTGG + Intronic
943312081 2:186338441-186338463 GTCTACAATCCATCTTGAATTGG + Intergenic
946171629 2:217899159-217899181 CTCCACACCCCACCTGGACTGGG - Intronic
947760278 2:232599138-232599160 CTCGACCCCCCACCTTGGGTGGG + Intergenic
948581214 2:238988369-238988391 GTCCACACCACACCTGTAGTGGG + Intergenic
1169586124 20:7087488-7087510 CTCTACACCCCTCCTTGATTTGG + Intergenic
1184904448 22:47471281-47471303 GGCTCCTCCCCACCATGAGTAGG - Intronic
950067738 3:10126689-10126711 GTCTCCTCCCCACCTTTGGTGGG + Exonic
950172468 3:10848529-10848551 CCCTACACCCCAGCTTCAGTAGG + Intronic
950642880 3:14359837-14359859 GTCTTCACCCCACCTGGAACTGG - Intergenic
951269829 3:20610160-20610182 GTCTTTAATCCACCTTGAGTTGG - Intergenic
953147784 3:40294740-40294762 TCCTACACCCCACCCTGAGCTGG + Intergenic
953623510 3:44552357-44552379 TTCTGCACCCCACCTAGATTAGG - Intergenic
954240424 3:49289394-49289416 GTCCACCCCACACCTTGAGCTGG + Intronic
960757734 3:121035356-121035378 GTCTTTACTCCATCTTGAGTTGG + Intronic
960997989 3:123352074-123352096 CACTGCACCCCGCCTTGAGTTGG - Intronic
962481096 3:135799479-135799501 GTCTAAACCCCTCCTTGGGCAGG + Intergenic
964898148 3:161622881-161622903 CTCTCCACCCCACCTTGTGTTGG - Intergenic
964963470 3:162458302-162458324 CTCTTTACCCTACCTTGAGTGGG + Intergenic
967181586 3:186909835-186909857 GGCTACACCCCACCCTGCTTTGG + Intergenic
973592677 4:52458524-52458546 GTCGACACCCCGCCCTGATTTGG + Intergenic
980940771 4:139272074-139272096 GCCTACACCTCAACTAGAGTGGG + Intronic
993339314 5:86703385-86703407 GTGAACACTCAACCTTGAGTTGG + Intergenic
996109148 5:119544248-119544270 GTCTGTAACCCATCTTGAGTTGG + Intronic
997590083 5:135067035-135067057 GCCTCCACCCCACCTGGAGGTGG - Intronic
1001958046 5:175861810-175861832 GCCTACACCCCCTCTTGAGGGGG - Intronic
1003664233 6:8094801-8094823 GTCTTCACTTCACATTGAGTAGG - Intronic
1003736133 6:8879490-8879512 GACTGCACCCCAACTTGAGAAGG + Intergenic
1008857624 6:56110950-56110972 GTCTACACCCCACCTTGAGTAGG + Intronic
1010865154 6:80967565-80967587 GTCTATAGCCCACCTTTAATGGG + Intergenic
1012355146 6:98305075-98305097 GTCTACACAACATCTTGATTTGG - Intergenic
1018551060 6:164999438-164999460 CTCTTTACCCCACCTTCAGTGGG + Intergenic
1024278274 7:47696985-47697007 GTCTTCACCCCTCCATCAGTGGG - Intronic
1024971187 7:55072279-55072301 CTCTAAAATCCACCTTGAGTAGG - Intronic
1029551863 7:101240817-101240839 GTCCCCACCTCACCTTGAGCCGG + Exonic
1033974172 7:147079359-147079381 GTCTTCATCCCACCGTTAGTGGG + Intronic
1035013718 7:155744566-155744588 ATTTACACCCCACCTTTTGTTGG + Intronic
1037647860 8:20810179-20810201 GTCTCCAGCCCACCCTGAGAAGG - Intergenic
1051874412 9:21776292-21776314 GACTAAATCCCAACTTGAGTGGG + Intergenic
1052813974 9:33085599-33085621 GACAACACCCCACCTTGCTTTGG - Intergenic
1057476120 9:95404028-95404050 GTCTTCAATCCATCTTGAGTTGG - Intergenic
1062490133 9:136800991-136801013 ATCTACAGCCCATCTGGAGTAGG - Intronic
1186392981 X:9180005-9180027 GTCTCCTCCCCACCTTTGGTGGG + Intergenic
1186921853 X:14291130-14291152 GTCAACCCCTAACCTTGAGTAGG - Intergenic
1199423402 X:147673596-147673618 GTCTAAAATCCACCTGGAGTTGG - Intergenic