ID: 1008860814

View in Genome Browser
Species Human (GRCh38)
Location 6:56147973-56147995
Sequence AGAAGACAGCCTATGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008860814 Original CRISPR AGAAGACAGCCTATGAGGGA GGG (reversed) Intronic