ID: 1008860814

View in Genome Browser
Species Human (GRCh38)
Location 6:56147973-56147995
Sequence AGAAGACAGCCTATGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 266}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008860814 Original CRISPR AGAAGACAGCCTATGAGGGA GGG (reversed) Intronic
902460047 1:16567745-16567767 AGAATACAGCTTTTGAGGTATGG + Intronic
903061180 1:20670005-20670027 AAAAGACAGAATATGAGAGACGG + Intronic
903267075 1:22163913-22163935 AGAAGCCAGGCCATGTGGGAGGG + Intergenic
905415445 1:37800621-37800643 AGAAGACAGATGATGTGGGAAGG - Exonic
906271605 1:44483821-44483843 AGAAAAAATCCTAAGAGGGAAGG - Intronic
907856869 1:58312184-58312206 AGAAGACATCCTAAGAGAGCAGG + Intronic
909527576 1:76644063-76644085 AGAAAACAGACTAAGAGGGGGGG - Intergenic
909578607 1:77205808-77205830 AGAAGACATGCTCTGAGTGAAGG + Intronic
912008592 1:104932926-104932948 GGGAGGCAGCCTAGGAGGGAAGG + Intergenic
913240329 1:116824839-116824861 AGAAGACACCTGCTGAGGGAAGG + Intergenic
913272867 1:117111203-117111225 AGAAGGCACACTATGAGTGAAGG + Exonic
913605367 1:120460836-120460858 AGAATACAGCTTTTGAGGTATGG - Intergenic
913642235 1:120823572-120823594 AGAATACAGCTTTTGAGGTATGG - Intronic
913989799 1:143600456-143600478 AGAATACAGCTTTTGAGGTATGG + Intergenic
914083170 1:144428372-144428394 AGAATACAGCTTTTGAGGTATGG + Intronic
914211047 1:145579361-145579383 AGAATACAGCTTTTGAGGTATGG + Intergenic
914276244 1:146126794-146126816 AGAATACAGCTTTTGAGGTATGG + Intronic
914366576 1:146984397-146984419 AGAATACAGCTTTTGAGGTATGG - Intronic
914380765 1:147113985-147114007 AGAATACAGCTTTTGAGGTATGG + Intergenic
914485870 1:148109050-148109072 AGAATACAGCTTTTGAGGTATGG + Intronic
914537290 1:148577749-148577771 AGAATACAGCTTTTGAGGTATGG + Intronic
914586203 1:149064197-149064219 AGAATACAGCTTTTGAGGTATGG + Intronic
914628635 1:149487595-149487617 AGAATACAGCTTTTGAGGTATGG - Intergenic
914917885 1:151829551-151829573 AGACGCCAGGCTCTGAGGGAAGG - Intronic
915521648 1:156448688-156448710 AGAAGACAGCCTCAGGCGGAAGG + Intergenic
916166616 1:161971606-161971628 AGAGGACAGTCTAGGGGGGAGGG - Intergenic
916194383 1:162209886-162209908 TGAAGAAAGCTTAGGAGGGAAGG + Intronic
916973027 1:170044519-170044541 TGAAGACATTCTATGATGGAAGG + Intronic
918060423 1:181056487-181056509 TGAAGACAACCTATGTAGGAAGG - Exonic
919178297 1:194048094-194048116 AGAAGGCAGCCTAGGAGAGTGGG + Intergenic
919763189 1:201111121-201111143 AGAAGAGAGGCAAGGAGGGAGGG + Intronic
923969536 1:239184218-239184240 TGAAGACAGCCTATAAGGGCTGG + Intergenic
924562135 1:245165664-245165686 AGAAGACAGACCAAGAAGGAGGG + Intronic
1064136297 10:12753744-12753766 AGAATACAGGCCATGAGAGAAGG - Intronic
1067227026 10:44383114-44383136 GGAAGTCAGCCAATGGGGGAGGG + Intronic
1067342309 10:45416017-45416039 AGATGACAGTCTATGAGGGTGGG + Intronic
1068509129 10:57941531-57941553 GGAAGACAGAGTATGAGAGATGG - Intergenic
1069408871 10:68131672-68131694 AGAATACCGCCTATGAAGGCTGG - Intronic
1070752918 10:78974324-78974346 TGAAAACAGCCTGGGAGGGAGGG + Intergenic
1071666233 10:87561633-87561655 AGGAGTGAGCCTATGAGGGCTGG - Intergenic
1074939165 10:118218010-118218032 AAAACACTGTCTATGAGGGACGG - Intergenic
1075419263 10:122288785-122288807 AGAAGACCCCCGATGAGGAAGGG + Intronic
1075747288 10:124736658-124736680 AGAGGGCAGCCTGGGAGGGAGGG + Intronic
1079091769 11:17485728-17485750 AGAAGACAGCCTGGTTGGGAAGG + Intergenic
1080886438 11:36372376-36372398 ACAAGGCAGCCTCTCAGGGAGGG + Intronic
1081323216 11:41716269-41716291 AGAAGAAAGACTTTGACGGAGGG + Intergenic
1081350472 11:42045572-42045594 AGAAGACAGAGTATCAGTGAAGG + Intergenic
1081713038 11:45230238-45230260 AGAAGGCAGCATATGAGGCCTGG - Intronic
1081994364 11:47354071-47354093 AGTAGACAGCCTGGGAGTGAGGG - Intergenic
1082833468 11:57636539-57636561 AGTACTCAGCCTATGAGGAACGG - Intergenic
1083161755 11:60858732-60858754 AGAAGAAAGCCCATGTGGGCTGG - Intergenic
1083923404 11:65792278-65792300 AGGAGACAGCAGGTGAGGGACGG - Intronic
1086137739 11:83459293-83459315 AGATGACATACTATCAGGGAAGG - Exonic
1089011483 11:115135698-115135720 TGAAGAGAGCCTATGAGGCCAGG + Intergenic
1089579306 11:119471445-119471467 GGAAGACAGCCTGGGAGTGAGGG - Intergenic
1090287855 11:125515746-125515768 AGAAAACAGGCTCTCAGGGATGG + Intergenic
1090421065 11:126575266-126575288 AGAAGCCAGCCTAGGAAGGTTGG + Intronic
1091860852 12:3781815-3781837 ACAAGACAGCCCTTGGGGGATGG - Intergenic
1092099868 12:5874178-5874200 AAAAGAGAGGCTGTGAGGGATGG + Intronic
1092107046 12:5928727-5928749 AGAAGACAGACTAGTAAGGAAGG - Intronic
1092107076 12:5929097-5929119 AGAAGACAGACTAGTAAGGAAGG - Intronic
1092107169 12:5930125-5930147 AGAAGACAGACTAGTAAGGAAGG - Intronic
1092107395 12:5931513-5931535 AGAAGACAGACTAGTAAGGAAGG + Intronic
1092107413 12:5931735-5931757 AGAAGACAGACTAGTAAGGAAGG + Intronic
1092206236 12:6615784-6615806 AGGAGACAGACTTTGAGGAAGGG + Intergenic
1092950219 12:13495988-13496010 AGATGACTGAGTATGAGGGATGG - Intergenic
1093326423 12:17780810-17780832 AGAAAATAGCCAATTAGGGAGGG + Intergenic
1093813935 12:23520412-23520434 GGAAGAAAGCCTATCAGTGATGG - Intergenic
1098062352 12:66576527-66576549 AGAAGACAGCCTTTGAATTAAGG + Intronic
1100064645 12:90627229-90627251 ACCAGACAGCCTAGGAGGGGCGG - Intergenic
1101896890 12:108763689-108763711 AGAAGACATCTTATTGGGGAAGG + Intergenic
1102184141 12:110934612-110934634 AGAAGAAAGACAAAGAGGGATGG + Intergenic
1102997181 12:117360150-117360172 AGAAGGCAGCCGAGGAGGGCAGG - Intronic
1105720426 13:23108210-23108232 ACAACACAGCCTAAGAGGAAGGG - Intergenic
1106246829 13:27957486-27957508 AGAAGACAGCAGATGAGGCCGGG + Intergenic
1106499915 13:30318022-30318044 AGCAGCCAGCCAGTGAGGGAAGG + Intergenic
1107737282 13:43413126-43413148 ACAAGACAGCCGCTGAGCGATGG - Intronic
1109831928 13:67802211-67802233 ACATGACAGACCATGAGGGAGGG - Intergenic
1110834330 13:80066497-80066519 AGAAGAAAGGCAAGGAGGGAAGG + Intergenic
1111020690 13:82445255-82445277 ACAAGACCGACTATCAGGGAGGG - Intergenic
1111840350 13:93441927-93441949 AGAAGAAAGAGTAGGAGGGATGG + Intronic
1115329028 14:32173855-32173877 AGAAGAAAGACAAAGAGGGAGGG - Intergenic
1115334411 14:32230808-32230830 TAAAGACAGACTATGTGGGAAGG + Intergenic
1117043544 14:51789966-51789988 AGAAGACAGAATGAGAGGGATGG + Intergenic
1117469390 14:56026591-56026613 AGAAGACAGCATGTGAGTCAAGG - Intergenic
1117988448 14:61411122-61411144 TGAAGACAGCCTCTGTTGGATGG - Intronic
1118504145 14:66392182-66392204 ATAAGATAGCCTATTAAGGAGGG + Intergenic
1119524464 14:75311074-75311096 AGAAGCCGGCCTGAGAGGGACGG + Intergenic
1119975211 14:79017389-79017411 AGATGAAAAACTATGAGGGAGGG - Intronic
1124239145 15:28015572-28015594 AGAAGACAGGCACAGAGGGATGG + Intronic
1129071771 15:72957380-72957402 AGAAAACAGAATAGGAGGGAAGG + Intergenic
1129248266 15:74293109-74293131 GGGAGACAGGCTATGGGGGAGGG + Intronic
1129638028 15:77343398-77343420 AAAAGACAACCTATGAAGAATGG - Intronic
1130549945 15:84884116-84884138 AGGAGACAGCCTCTGAGGCCCGG - Intergenic
1130607129 15:85328053-85328075 AGAACCAAGCCTATGAGCGAGGG + Intergenic
1132890841 16:2203834-2203856 AGAAGGCAGCCTTTCAGGCATGG + Intergenic
1133207653 16:4243033-4243055 AGAAGCCAGCCTTGGAGGAAAGG + Intergenic
1133375668 16:5284800-5284822 AGCAGACAGGCTATGAGAAAAGG - Intergenic
1133604960 16:7377950-7377972 AGAAGACAGCCAGGGAGGTATGG + Intronic
1134220889 16:12353073-12353095 AGAAGACAGGGTGTCAGGGAAGG - Intronic
1136179597 16:28542037-28542059 AGAAAGAAGCCTATGAGAGAAGG + Intergenic
1136477558 16:30522991-30523013 AGAAGACAGCCTCCAAGGGTGGG - Exonic
1138293938 16:55870863-55870885 AGAAGAAAGCCACTGAGGAAAGG + Intronic
1139341347 16:66270039-66270061 AGAAGAGAGACGAGGAGGGAGGG + Intergenic
1139697395 16:68684934-68684956 AGAAGAGAACCTATGCAGGAGGG - Intronic
1140106697 16:71967232-71967254 AGAAGACAGTCTTTGAACGAGGG - Exonic
1140679783 16:77373831-77373853 ATAAAACTGCATATGAGGGATGG - Intronic
1140869844 16:79096367-79096389 AGAACAGAGCCAATGGGGGAAGG - Intronic
1141905613 16:87024227-87024249 AGAAGACAGCCAATAAGAAAAGG + Intergenic
1142965308 17:3577348-3577370 AGAACAAAGGCTATGGGGGAAGG - Intronic
1145292945 17:21564190-21564212 ACAAGAAAACCTATGGGGGATGG + Intronic
1145387020 17:22421742-22421764 ACAAGAAAACCTATGGGGGATGG - Intergenic
1147952234 17:44113694-44113716 AGAGTGCAGCCTTTGAGGGAGGG - Intronic
1147983292 17:44288517-44288539 AGAAGATAGCTCAGGAGGGATGG - Intergenic
1148105685 17:45117724-45117746 AGAAGAAAACCTTTGGGGGAGGG - Intronic
1148775002 17:50090275-50090297 AGGACACAGCCCATGGGGGAGGG - Intronic
1150192692 17:63259518-63259540 GGAAAAAAGCCTACGAGGGAAGG - Intronic
1151381622 17:73729839-73729861 AGAAGACATCACATGAGAGAGGG + Intergenic
1155345132 18:24850149-24850171 AGAAGTCAGCCTGTGAAGGGAGG - Intergenic
1156491569 18:37499478-37499500 AGGGGACAGCCTGGGAGGGACGG + Intronic
1156900220 18:42291948-42291970 AGAAGAAAATCTAAGAGGGATGG + Intergenic
1157239908 18:45999227-45999249 AGAAGCATGGCTATGAGGGAGGG - Intronic
1157588131 18:48818263-48818285 GGAAGACAGCCTCGGAGTGAGGG + Intronic
1157933523 18:51849232-51849254 AGAGGGCAGCCTATGACAGAGGG - Intergenic
1158200320 18:54932068-54932090 AGAAGACAGGCTGTGAGGAAGGG - Intronic
1159480633 18:68986849-68986871 TGAAGACATCTTATGAAGGAAGG + Intronic
1159877133 18:73825283-73825305 AGAAGAGAGCAGATGAGGCAGGG + Intergenic
1161168809 19:2802789-2802811 AGAAGACAGGCAAGGAGGGAAGG - Intronic
1164524045 19:29000563-29000585 AGAAGGCAGCTTATGGGGGGAGG - Intergenic
1164926280 19:32132379-32132401 ATAAGACAGCCCATGAGATAGGG + Intergenic
1166049213 19:40248099-40248121 AGAGGACAGGCTCTGGGGGATGG + Intronic
1167017420 19:46850239-46850261 AGGAGACTGCCTGTGAGAGAGGG - Intronic
1167046736 19:47054161-47054183 AGAAGACAGGCTAAGGGAGAAGG + Intergenic
1167322477 19:48805647-48805669 AGGAGACAGCCCAGGGGGGATGG - Intronic
1167686965 19:50962530-50962552 AAGAGAGAGCCAATGAGGGAGGG - Intronic
1202676478 1_KI270711v1_random:11473-11495 AGAATACAGCTTTTGAGGTATGG + Intergenic
926509629 2:13758685-13758707 AGAAGACAAGCTGTGAGTGATGG - Intergenic
926591474 2:14744618-14744640 AGAAGACAGCCATGGATGGATGG + Intergenic
927693356 2:25223608-25223630 AGAAGAAAGTCTATCAGGGCCGG - Intergenic
929521182 2:42652390-42652412 AAAAGACAGCCTTTCAGGGCTGG + Intronic
930147766 2:48024920-48024942 AGAAGACATCATGTGGGGGAGGG + Intergenic
931181511 2:59906005-59906027 AAAAGAAAGCCAAAGAGGGAAGG + Intergenic
933503921 2:83153486-83153508 AGATGAATGCCCATGAGGGAAGG + Intergenic
933506595 2:83183522-83183544 AGCAGTCAGACTATGAGGAAGGG + Intergenic
933777031 2:85777320-85777342 CAAAAACAGCCTATGAGGGCAGG + Intronic
934653883 2:96107531-96107553 AGAGGACAGCCTGAGAGGGCAGG - Intergenic
934956876 2:98630500-98630522 AGAAGAGAAGCTATTAGGGACGG + Intronic
935646559 2:105340875-105340897 AGAAGACAGAGTAGGAGGGTAGG + Intronic
937027019 2:118707410-118707432 AGCAGACTGCCTTTGAGGCAGGG - Intergenic
937667010 2:124499365-124499387 AGAAGGCAGCCACTGTGGGATGG + Intronic
939021459 2:136962602-136962624 AGAAAACAGTCTCTGAGGGCAGG + Intronic
941037018 2:160579926-160579948 AGGACACAGCCTCTGAGGGCAGG - Intergenic
941524775 2:166593268-166593290 AGAAGAAAGCAGATGAGTGAGGG - Intergenic
941625531 2:167826539-167826561 AGAAGACACCCTGTCAGGAATGG + Intergenic
942157474 2:173146038-173146060 AGAACAGAGCCCATGAGGGTTGG + Intronic
943819090 2:192296237-192296259 ATAAGACAGCATAAGAGGGCTGG - Intergenic
944656477 2:201881012-201881034 AAAAGAAAGCTTAGGAGGGAGGG + Intronic
945707508 2:213254245-213254267 AGAAGAGTGCCTATGGCGGAAGG - Intergenic
947808487 2:232984517-232984539 TGAAGACAGCCTTCCAGGGAAGG + Intronic
948281818 2:236752885-236752907 AGAAGACAGCAGAGGAGGGGAGG - Intergenic
948382162 2:237558393-237558415 GGAAGAAAGACTAGGAGGGAGGG + Intergenic
948707233 2:239802473-239802495 CGAAGACAGCGTCAGAGGGAAGG + Exonic
1169321134 20:4634275-4634297 AGATGACAGCAGAGGAGGGATGG - Intergenic
1169946571 20:10995392-10995414 AGAGGACAGCCCAAGAGAGAAGG + Intergenic
1171409532 20:24936727-24936749 AGAAGACAGCCTGTGACTGTTGG + Intergenic
1172830912 20:37833621-37833643 AGAGAACAGCCTCTAAGGGAGGG - Intronic
1176706180 21:10121188-10121210 AGCACAAAGCCCATGAGGGAAGG + Intergenic
1177691231 21:24510221-24510243 AGAAGACTGCCATTGATGGAAGG + Intergenic
1178610294 21:34073754-34073776 GGAAGACCGGCTCTGAGGGAAGG - Intronic
1181759502 22:25048462-25048484 AGAAAAGAGGCTGTGAGGGAAGG + Intronic
1182973328 22:34598393-34598415 AGAAGACATCCAAAGAGGAAGGG + Intergenic
1183340707 22:37279548-37279570 TGCAGACAGCCTGGGAGGGAGGG - Intergenic
1183526596 22:38326748-38326770 AGATGACAGACAGTGAGGGAGGG - Intronic
1183569113 22:38639046-38639068 AGGAAACAGCCTTGGAGGGAGGG - Intronic
1184066312 22:42123788-42123810 AGAAGCCAACCTCTGAGGTAAGG + Intergenic
1184068780 22:42135940-42135962 AGAAGCCAACCTCTGAGGTAAGG + Intergenic
1185001615 22:48249806-48249828 AGAAGAAAGCCTTTGAGTCATGG - Intergenic
952983558 3:38757801-38757823 TGAAGATGGCCTATGAAGGAAGG + Intronic
955600036 3:60635430-60635452 AGAAAACGGCTTATGAAGGAGGG - Intronic
959421269 3:106132376-106132398 ACAAGACCTCCTATGATGGAAGG + Intergenic
960581604 3:119283609-119283631 AGGAGACAGAGAATGAGGGAGGG - Intergenic
963276751 3:143339101-143339123 AGTTGACAGCTTTTGAGGGATGG + Intronic
963942344 3:151107614-151107636 AAAAGACAGCGTATGTGGGATGG + Intronic
964186038 3:153944246-153944268 GGAATACAGCTTAGGAGGGAGGG - Intergenic
965020836 3:163228919-163228941 AGCTAACAGCCAATGAGGGAGGG - Intergenic
965275878 3:166681381-166681403 TCAAATCAGCCTATGAGGGATGG - Intergenic
965441448 3:168720326-168720348 AGAAAACAGACTATGATAGAAGG - Intergenic
967330137 3:188282068-188282090 AGAAAACAGAATATAAGGGAAGG - Intronic
967920039 3:194607783-194607805 AGTAGACAGGCTATGATGGGAGG + Intronic
969405561 4:6989246-6989268 AGAGGAGAGACTATGAGGTATGG - Intronic
970130420 4:12863492-12863514 AGAAGGCAGCCTTTGAGGCCAGG + Intergenic
971420746 4:26471981-26472003 AGAAGAGAGGCAAAGAGGGATGG - Intergenic
974546693 4:63319107-63319129 AGAAGACAGACTGTAAGGCAAGG + Intergenic
975405297 4:73981832-73981854 AGAAGCCAGGCTGTGAGGGCTGG - Intronic
976185126 4:82435741-82435763 AGAAGACAGCCTACAAGGAATGG + Intronic
976767293 4:88610597-88610619 AGAAGACAGACAAGGAGGGTGGG - Intronic
977384580 4:96323554-96323576 AGAAGACACCCTGGGAGGTAAGG - Intergenic
977597683 4:98901532-98901554 AGAAGAATGCCTATGAAGGATGG - Intronic
979113492 4:116789637-116789659 AGAAGACATCCCATAATGGAAGG - Intergenic
981396398 4:144254750-144254772 AGAAAACAGCCAATGATGGCAGG - Intergenic
982307667 4:153950453-153950475 TAAAGAAAGCTTATGAGGGAGGG + Intergenic
983756189 4:171339993-171340015 TGAAGAAAGCCTATGAGGATAGG - Intergenic
984307503 4:178014362-178014384 AGAAGACAACATAGGAGGGAAGG - Intergenic
985155240 4:186980797-186980819 AGAAGACAGCCTAAAAGAAAAGG + Intergenic
986061125 5:4192093-4192115 AGAAGACAGCCATTGAGTGTGGG + Intergenic
986772324 5:10985541-10985563 AAAATGCAGCCTATGAGGGCTGG - Intronic
987250942 5:16100635-16100657 AGAGGGCAGCCTTTGATGGAAGG - Intronic
987683641 5:21168385-21168407 AGAACACAGACAATGAGGGAGGG - Intergenic
987822332 5:22981721-22981743 AGATGCCATCTTATGAGGGATGG + Intergenic
988819365 5:34865677-34865699 ACATGACAGCCAATGAGGGTAGG + Intronic
988970841 5:36465750-36465772 AGAACACAGCACCTGAGGGAAGG + Intergenic
989644046 5:43610102-43610124 AGGAGACATTCTATCAGGGAAGG - Intronic
992076472 5:73197056-73197078 AGAAGACTGCAGTTGAGGGAGGG + Intergenic
992207829 5:74448085-74448107 AGAAGAAAGGCTATGGGTGAAGG + Intergenic
992430054 5:76701776-76701798 AGAAGTCAGGCTTTGAAGGAAGG - Intronic
999279461 5:150355484-150355506 AGAAGACAGTGTATGTGGGGGGG - Intergenic
1000043199 5:157500559-157500581 ATAAGAAAGCCTAGGAGGGTTGG - Intronic
1000119382 5:158182047-158182069 GGAGGAAAGCCTATGAGAGACGG + Intergenic
1000772012 5:165366236-165366258 AGAAGAGAGGCTTGGAGGGAGGG + Intergenic
1001877544 5:175214490-175214512 AGCAGACTGCCTAGGAAGGAGGG - Intergenic
1002668864 5:180848831-180848853 AGAAGAGAACCTATGAGGGAGGG - Exonic
1004968640 6:20883270-20883292 GGAAGACAACGTATGAGAGAAGG - Intronic
1006627551 6:35408107-35408129 AGAAGACAGGGTAGGAGGGTGGG - Intronic
1007250118 6:40489707-40489729 AGAAGACAGACCCTGAGGGAAGG - Intronic
1008447512 6:51610234-51610256 AGAAGACAGCCAGTGTGGAAAGG - Intergenic
1008860814 6:56147973-56147995 AGAAGACAGCCTATGAGGGAGGG - Intronic
1008966339 6:57316848-57316870 AGAACCCAGCCTCGGAGGGAAGG - Intronic
1010065682 6:71680168-71680190 AGGAGGCAGCCTGTGAGGAATGG + Intergenic
1010515205 6:76764216-76764238 ATAAAACAGATTATGAGGGAAGG - Intergenic
1011560167 6:88606162-88606184 TCAAGAGAGCCTAGGAGGGAAGG + Intergenic
1012225803 6:96702143-96702165 AGTAGACAGCCTGTGAGGTTGGG - Intergenic
1012578699 6:100836217-100836239 AAAAGACATCCAATGTGGGAAGG - Intronic
1012647848 6:101710705-101710727 TGAAGACAGCCTACGCGGAAAGG - Intronic
1014014493 6:116514307-116514329 GGAAGACAGACGATGAAGGAAGG + Intronic
1014796719 6:125733454-125733476 AAAAGAAAGCCTATGAAGAAAGG + Intergenic
1015340908 6:132099391-132099413 AGAAGCCAGTCTAATAGGGAAGG - Intergenic
1016161148 6:140881448-140881470 AGAAGACACTGTATGAGGGGAGG - Intergenic
1018380226 6:163252297-163252319 AGATGACAGCCTAGGAACGAAGG - Intronic
1019165050 6:170093322-170093344 ACAACACAGCCCAGGAGGGAAGG - Intergenic
1019648070 7:2141554-2141576 AGAAGGCACCGCATGAGGGAGGG + Intronic
1020141529 7:5614630-5614652 AGAAGTGAGGCTTTGAGGGAGGG + Intergenic
1022854855 7:34304306-34304328 AGAAGACAGGCTAAGGGAGAAGG + Intergenic
1023364134 7:39446164-39446186 AGAAGCCAGAGTATGTGGGAAGG - Intronic
1023855071 7:44177936-44177958 AGAAATCAGCCTATGAGGGCGGG + Intronic
1026566891 7:71496596-71496618 AGGAGAGAGACCATGAGGGAGGG + Intronic
1028399334 7:90407809-90407831 AGGAGAAAGACCATGAGGGAAGG + Intronic
1030111406 7:106030133-106030155 AGAGGGCAGCATGTGAGGGAAGG + Intronic
1030273663 7:107696707-107696729 GGAAAACAGCCTGTGAGGGAAGG + Intronic
1031159556 7:118149983-118150005 AGAAGACGGCATTTGAGGAAAGG + Intergenic
1031214156 7:118869631-118869653 AGTACCCAGCCTATGAGGAAAGG + Intergenic
1031562167 7:123251572-123251594 AGCCCACAGCATATGAGGGAGGG - Intergenic
1033025873 7:137771803-137771825 AGGACTCAGCCTGTGAGGGAAGG + Intronic
1035005561 7:155656825-155656847 AGAAGACAGGAAATGAGGTAAGG - Intronic
1035346848 7:158205987-158206009 TGAAGGCTGCCTATGATGGAAGG + Intronic
1036504439 8:9342539-9342561 ATAAGTCAGCCTAAGAGGGCTGG + Intergenic
1037639470 8:20729731-20729753 AGAAGGCAGCAGAAGAGGGAGGG - Intergenic
1038398493 8:27265084-27265106 AGAAGAAAACCTTTGTGGGATGG + Intergenic
1040273516 8:45984782-45984804 AGAAGAAAGCATATCAGTGATGG - Intergenic
1040983408 8:53268490-53268512 AGAAGACCGCCCAAGTGGGAAGG + Intergenic
1042672317 8:71278349-71278371 AGAAAACAGCGTATTAAGGAAGG - Intronic
1046776432 8:118168549-118168571 AGAAGACAACCTAAGAGAAAAGG - Intergenic
1048031394 8:130636540-130636562 AGAAGAAAACCTGTGAGGGAAGG + Intergenic
1048574658 8:135681193-135681215 AGAACATAGCCTCTCAGGGAGGG - Intergenic
1048784495 8:138035989-138036011 AGAAAACATCCTATAAGTGAAGG + Intergenic
1049549259 8:143249260-143249282 AGAACCCAGCCTCTGGGGGATGG + Intronic
1050185304 9:2966536-2966558 AGATGACAGCCTCTGAGAAAAGG - Intergenic
1053643463 9:40108306-40108328 AGCACAAAGCCCATGAGGGAAGG + Intergenic
1054324318 9:63705533-63705555 AGCACAAAGCCCATGAGGGAAGG + Intergenic
1054541289 9:66268298-66268320 AGCACAAAGCCCATGAGGGAAGG - Intergenic
1055132054 9:72786810-72786832 TGAAGACAGCCTCCCAGGGAAGG - Intronic
1055252015 9:74319077-74319099 AGATGAAAGCCTATGGAGGAAGG - Intergenic
1056735454 9:89205840-89205862 AGGAGACAGCCTTTCAGGGAGGG - Intergenic
1060184197 9:121553845-121553867 AGAAGTAAGTCTATGAGGGCAGG + Intergenic
1060445348 9:123682024-123682046 AGAAGAAAGCGCATGAGCGATGG + Intronic
1061442985 9:130619139-130619161 AAAAGAAGGCCTCTGAGGGAGGG - Intronic
1061886857 9:133595567-133595589 AGAAGCCAGCCAAGGAGGGAGGG - Intergenic
1202791214 9_KI270719v1_random:91276-91298 AGCACAAAGCCCATGAGGGAAGG + Intergenic
1187164715 X:16794298-16794320 CGAAGACAAATTATGAGGGATGG + Intronic
1188118919 X:26280797-26280819 AGAAGACAGCATATGAGCCACGG + Intergenic
1191683912 X:63869591-63869613 AGAAGCCAGGCTATGGGGGAAGG - Intergenic
1192732481 X:73815183-73815205 GGAAGTAAGCCTATAAGGGAAGG - Intergenic
1195568659 X:106374819-106374841 AGAATACAGCTAATGAGGGAAGG + Intergenic
1196754680 X:119147741-119147763 AGAAGACAGGCTTGGAGAGAAGG + Intronic
1198861583 X:141076549-141076571 TGAAGAAAGCCTATCAGAGAAGG - Intergenic
1198901108 X:141510834-141510856 TGAAGAAAGCCTATCAGAGAAGG + Intergenic
1199567267 X:149229172-149229194 AGAAGAAAGAATATTAGGGATGG - Intergenic