ID: 1008864897

View in Genome Browser
Species Human (GRCh38)
Location 6:56198470-56198492
Sequence ATAAAAATTGTATATATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8208
Summary {0: 5, 1: 167, 2: 708, 3: 2180, 4: 5148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008864897_1008864898 3 Left 1008864897 6:56198470-56198492 CCTAAAATATATACAATTTTTAT 0: 5
1: 167
2: 708
3: 2180
4: 5148
Right 1008864898 6:56198496-56198518 TCAGTCTTACCTCAAAAAGCTGG 0: 1
1: 0
2: 3
3: 25
4: 134
1008864897_1008864899 4 Left 1008864897 6:56198470-56198492 CCTAAAATATATACAATTTTTAT 0: 5
1: 167
2: 708
3: 2180
4: 5148
Right 1008864899 6:56198497-56198519 CAGTCTTACCTCAAAAAGCTGGG No data
1008864897_1008864900 5 Left 1008864897 6:56198470-56198492 CCTAAAATATATACAATTTTTAT 0: 5
1: 167
2: 708
3: 2180
4: 5148
Right 1008864900 6:56198498-56198520 AGTCTTACCTCAAAAAGCTGGGG 0: 1
1: 0
2: 1
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008864897 Original CRISPR ATAAAAATTGTATATATTTT AGG (reversed) Intronic
Too many off-targets to display for this crispr