ID: 1008864899

View in Genome Browser
Species Human (GRCh38)
Location 6:56198497-56198519
Sequence CAGTCTTACCTCAAAAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008864897_1008864899 4 Left 1008864897 6:56198470-56198492 CCTAAAATATATACAATTTTTAT 0: 5
1: 167
2: 708
3: 2180
4: 5148
Right 1008864899 6:56198497-56198519 CAGTCTTACCTCAAAAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008864899 Original CRISPR CAGTCTTACCTCAAAAAGCT GGG Intronic
No off target data available for this crispr