ID: 1008864899 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:56198497-56198519 |
| Sequence | CAGTCTTACCTCAAAAAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1008864897_1008864899 | 4 | Left | 1008864897 | 6:56198470-56198492 | CCTAAAATATATACAATTTTTAT | 0: 5 1: 167 2: 708 3: 2180 4: 5148 |
||
| Right | 1008864899 | 6:56198497-56198519 | CAGTCTTACCTCAAAAAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1008864899 | Original CRISPR | CAGTCTTACCTCAAAAAGCT GGG | Intronic | ||
| No off target data available for this crispr | |||||