ID: 1008865482

View in Genome Browser
Species Human (GRCh38)
Location 6:56204646-56204668
Sequence GGGTCAGGGACCCACTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 523
Summary {0: 1, 1: 5, 2: 7, 3: 108, 4: 402}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008865482_1008865494 12 Left 1008865482 6:56204646-56204668 CCTCCACAGTGGGTCCCTGACCC 0: 1
1: 5
2: 7
3: 108
4: 402
Right 1008865494 6:56204681-56204703 ACTGGGAGATACCTCCAGTAGGG No data
1008865482_1008865486 -6 Left 1008865482 6:56204646-56204668 CCTCCACAGTGGGTCCCTGACCC 0: 1
1: 5
2: 7
3: 108
4: 402
Right 1008865486 6:56204663-56204685 TGACCCCCGTGTATCCTGACTGG 0: 37
1: 177
2: 501
3: 1697
4: 3818
1008865482_1008865487 -5 Left 1008865482 6:56204646-56204668 CCTCCACAGTGGGTCCCTGACCC 0: 1
1: 5
2: 7
3: 108
4: 402
Right 1008865487 6:56204664-56204686 GACCCCCGTGTATCCTGACTGGG 0: 42
1: 184
2: 504
3: 1717
4: 3858
1008865482_1008865493 11 Left 1008865482 6:56204646-56204668 CCTCCACAGTGGGTCCCTGACCC 0: 1
1: 5
2: 7
3: 108
4: 402
Right 1008865493 6:56204680-56204702 GACTGGGAGATACCTCCAGTAGG 0: 1
1: 2
2: 5
3: 24
4: 190
1008865482_1008865495 13 Left 1008865482 6:56204646-56204668 CCTCCACAGTGGGTCCCTGACCC 0: 1
1: 5
2: 7
3: 108
4: 402
Right 1008865495 6:56204682-56204704 CTGGGAGATACCTCCAGTAGGGG 0: 1
1: 4
2: 7
3: 78
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008865482 Original CRISPR GGGTCAGGGACCCACTGTGG AGG (reversed) Intronic
900181871 1:1314721-1314743 GGGTCAGGGTCTCAGGGTGGGGG - Intronic
900225695 1:1532778-1532800 GGGCCCCGGACCCACAGTGGTGG + Intronic
904235496 1:29114006-29114028 TGGTCAGGGGCCCACAGAGGTGG + Intronic
904335774 1:29796891-29796913 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
904865143 1:33572499-33572521 GACTCACGGACACACTGTGGTGG + Exonic
905353918 1:37367693-37367715 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
905371413 1:37484479-37484501 GGGTCAGGGAGCTGGTGTGGAGG - Intergenic
906032873 1:42734679-42734701 GGGTCAGGGAGCCCCTGGTGTGG - Exonic
906050340 1:42866327-42866349 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
906055070 1:42909506-42909528 TTGTCAGGGAACCAATGTGGAGG + Intergenic
906206966 1:43992062-43992084 GGGCCAGGGACCCGCAGAGGTGG - Intronic
906878759 1:49566740-49566762 GGGTTAGGGACCCCTTGAGGAGG + Intronic
906879535 1:49575367-49575389 CAGTCAGGGAGCCAATGTGGGGG - Intronic
907190172 1:52641562-52641584 GGGTGAGGGACCAGCAGTGGAGG + Intronic
907243573 1:53093565-53093587 GGGTCAGGGACACAGTGCTGTGG + Intronic
907552878 1:55319170-55319192 GGGTAAGGGAGCTGCTGTGGAGG + Intergenic
907565697 1:55431230-55431252 GGGTCAGGGACCCACTTGAGGGG - Intergenic
908616383 1:65927817-65927839 CAGTCAGGGAGCCAATGTGGGGG + Intronic
908898155 1:68924171-68924193 GGGTCAGGGACCCACTTGAGGGG - Intergenic
910721467 1:90291204-90291226 GGGTGATGGACCCATGGTGGTGG - Intergenic
911980303 1:104558495-104558517 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
912463270 1:109851729-109851751 GGGTCAGGGACCCACTTGAGAGG - Intergenic
912613998 1:111078954-111078976 GGGTCAGGGACCCACTTGAGGGG + Intergenic
912943957 1:114069283-114069305 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
913039593 1:115009493-115009515 CAGTCAGGGAGCCAATGTGGAGG + Intergenic
913337417 1:117721349-117721371 GGGTCAAGGACCCACTTGAGGGG - Intergenic
913515478 1:119601873-119601895 GAGGCAGGGACCCACTGGTGAGG - Intergenic
913710472 1:121477808-121477830 GGGTCAGGGACCCATTGAGGAGG - Intergenic
914839932 1:151240071-151240093 GGGTAAGGGAGCCACTGGGCAGG - Intronic
915106789 1:153539848-153539870 GGGTCAGGGTCTCACTGAGAAGG - Intronic
915450687 1:156002922-156002944 GGGTCAGGGAGAAACTGAGGAGG + Intronic
915531513 1:156504999-156505021 GGGGCAGGGAGCTTCTGTGGGGG - Intergenic
916038345 1:160941350-160941372 GGGTCAGGGACCCACTTGAGGGG + Intergenic
916106487 1:161436387-161436409 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
916285162 1:163098415-163098437 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
916673557 1:167046582-167046604 GGGTCAGGGTCTCCCTGAGGTGG + Intergenic
917217363 1:172692003-172692025 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
917890117 1:179428516-179428538 GGCCCAGGGACCCCTTGTGGGGG + Intronic
917903956 1:179571520-179571542 GGGTCAGGGACCCACTTGAGGGG + Intronic
919124763 1:193380856-193380878 AAGTCAGGGAGCCAATGTGGGGG + Intergenic
919230163 1:194763647-194763669 CAGTCAGGGAGCCAGTGTGGTGG + Intergenic
920197274 1:204237271-204237293 CAGTCAGGGAGCCAATGTGGGGG - Intronic
920400639 1:205674096-205674118 GGGGGTGGGACCCAATGTGGGGG + Intronic
921043231 1:211454067-211454089 GGGTCAGGGACCCACTTGAGGGG - Intergenic
923253721 1:232200530-232200552 CTGTCAGGGACCCAATGTGGGGG + Intergenic
923628183 1:235631279-235631301 GGTTCAGGGCTCCACTGAGGGGG - Intronic
924847291 1:247786320-247786342 GAGTCAGGGATCCAAGGTGGGGG + Intergenic
1062937836 10:1401196-1401218 AGCTGAGGGACCCACTGTGGAGG + Intronic
1063293856 10:4781724-4781746 GGGTCAGGGGCCCATAATGGAGG - Intergenic
1063836378 10:10019070-10019092 GGATCAGGGAGCCAGTGTGTGGG - Intergenic
1063916681 10:10890034-10890056 GGGTCAGGGTCACAATGAGGAGG + Intergenic
1064431117 10:15270575-15270597 GGGTCAGGGACCTACTTGAGAGG - Intronic
1066167185 10:32800340-32800362 CAGTCAGGGAGCCAATGTGGAGG + Intronic
1066595346 10:37044201-37044223 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1067289359 10:44930013-44930035 GAGTTAGGGACCCACTGGAGAGG - Intronic
1067339332 10:45388389-45388411 GGGTCAGGGAGCCACTTGAGGGG - Intronic
1067754496 10:48994825-48994847 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1068225492 10:54102700-54102722 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1068534851 10:58230345-58230367 GGGTCAGGGACCCACTTGAGGGG - Intronic
1070304984 10:75234589-75234611 GAGTAAGGGATCCACTGCGGGGG - Exonic
1070775889 10:79109585-79109607 GGATCAGGAACCCAGTGTGGGGG - Intronic
1070795972 10:79216424-79216446 GGCTCTGGGACCCACAGTTGGGG + Intronic
1070999789 10:80818549-80818571 GGGTCAGGGACTCACTTGAGGGG - Intergenic
1071074638 10:81735634-81735656 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1071364615 10:84885609-84885631 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1072480515 10:95806961-95806983 GGGTCAGGGACCCACTTGAGGGG + Intronic
1073185620 10:101613646-101613668 GGGTCAGGGTCTCAGTGAGGTGG - Intronic
1073557195 10:104464804-104464826 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1073656794 10:105425331-105425353 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1073854949 10:107663124-107663146 CAGTCAGGGAACCAATGTGGGGG - Intergenic
1073875259 10:107914913-107914935 GGGTCCGGGACCCGAGGTGGCGG + Intergenic
1073881976 10:107992532-107992554 GGGTCAAGGAAACACTCTGGGGG - Intergenic
1076063389 10:127430196-127430218 AGGTCAGGGGCCAACTGTGATGG - Intronic
1076172089 10:128327616-128327638 GGGTCAGGGCCCTTCTGTGGAGG - Intergenic
1076666027 10:132093211-132093233 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1076851623 10:133096078-133096100 GCTTCAGGGCCCCACTGTGTAGG - Intronic
1076898438 10:133325462-133325484 GAGTCAGAGACCCACGGGGGCGG + Exonic
1076902436 10:133346579-133346601 GGGTGAGGGTTCCACGGTGGTGG + Intronic
1077389970 11:2296275-2296297 AGGTCAGGGAACAAATGTGGGGG + Intronic
1079342507 11:19624210-19624232 GGGTCAGGGGCCCACTGAGGAGG + Intronic
1080204465 11:29712937-29712959 GGCTCAGGAGCCCACTGTGGGGG - Intergenic
1080346813 11:31334854-31334876 GGGTCAGGGACCCACTGAGGAGG + Intronic
1081110323 11:39127300-39127322 CAGTCAGGGAACCAGTGTGGGGG - Intergenic
1081592983 11:44437985-44438007 GGGTCAGTGACCCACTTAGGAGG - Intergenic
1082141728 11:48617198-48617220 GGGTCAGGGACTCATTGAGGAGG + Intergenic
1082281207 11:50273223-50273245 GGGTCAGGCACCTGCTGAGGGGG - Intergenic
1082282014 11:50280281-50280303 GGGTCAGGCACCTGCTGAGGAGG - Intergenic
1082568888 11:54714004-54714026 GGGTCAGGGACTCATTGAGGAGG + Intergenic
1083706182 11:64518006-64518028 GGCCCTGGGACCCACTGAGGCGG - Intergenic
1084386232 11:68844100-68844122 GGGACAGGGACCCAGTCTGTGGG + Intronic
1084594509 11:70108987-70109009 GGGCAAGGGACCCACTGTGGGGG - Intronic
1085156669 11:74301935-74301957 GGGTCAGGGACGCAAGGTTGGGG - Intronic
1085457019 11:76670933-76670955 GGGGCGGGGGCCCAGTGTGGGGG + Intergenic
1085685809 11:78621075-78621097 CAGTCAGGGAGCCATTGTGGGGG - Intergenic
1086529162 11:87763831-87763853 GGGTCAGGGACCCACTTGTGGGG + Intergenic
1086833972 11:91599274-91599296 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1087107369 11:94423737-94423759 GGGTCAGGCACCAGCTGTGCTGG - Intronic
1088449204 11:109964237-109964259 CTGTCAGGGAGCCAATGTGGGGG - Intergenic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1089903465 11:122012493-122012515 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1090416989 11:126547537-126547559 GGGTAGGGGACCCACTGCTGGGG + Intronic
1090688931 11:129156743-129156765 GGTTCAGGGACCCACTTGAGGGG - Intronic
1091051592 11:132377631-132377653 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1091089962 11:132762286-132762308 GGGTCAGGGACCCACTTGAGGGG + Intronic
1091586846 12:1821579-1821601 GGGTCAGGGAGCCTTAGTGGGGG + Intronic
1092263695 12:6965549-6965571 GGTTCAGGGAACCGGTGTGGGGG + Exonic
1092381233 12:7998739-7998761 CAGTCAGGGAGCCACTGTGGGGG - Intergenic
1093036148 12:14334223-14334245 CAGTCAGGGAGCCACTGTGGTGG - Intergenic
1093530827 12:20161070-20161092 GGGTCAGGTACCCACTGACGAGG + Intergenic
1094102382 12:26778142-26778164 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1094311869 12:29093041-29093063 GGGTCAGGGACCACTTGAGGAGG - Intergenic
1095089677 12:38092016-38092038 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1095121648 12:38425962-38425984 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1095591345 12:43907166-43907188 GGGTCAGGGACCCACTTGAGGGG - Intronic
1095845302 12:46737647-46737669 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1095856377 12:46864784-46864806 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1095938687 12:47711762-47711784 GGGTAAGAATCCCACTGTGGAGG + Exonic
1097076856 12:56401374-56401396 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1098715943 12:73828690-73828712 TAGTCAGGGAGCCAATGTGGGGG - Intergenic
1098730908 12:74036229-74036251 CAGTCAGGGAGCCAATGTGGAGG - Intergenic
1098733163 12:74064532-74064554 TAGTCAGGGAGCCAGTGTGGGGG - Intergenic
1098749698 12:74278402-74278424 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1098839933 12:75466587-75466609 GGGTCAGGGACCCACTTGAAGGG + Intergenic
1099492107 12:83300414-83300436 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1100083172 12:90877119-90877141 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1101534826 12:105607225-105607247 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1103035460 12:117652936-117652958 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1103443541 12:120980011-120980033 AGGTCAGGGAGCCGCTGGGGAGG - Intronic
1103558712 12:121780993-121781015 ACCTCAGGGAACCACTGTGGAGG + Exonic
1104086322 12:125477783-125477805 GGGTCAGGGACCCACTTGAGGGG - Intronic
1105252410 13:18711336-18711358 GGGTGATGGACCCATGGTGGTGG + Intergenic
1106448044 13:29854060-29854082 GGGGCAGGGGCCCAGTGTGAGGG + Intergenic
1108226294 13:48293233-48293255 GGGTCAGGGAGCCAATGTGAAGG + Intergenic
1108385493 13:49895787-49895809 GAGGCTGGGACCCACAGTGGAGG - Intergenic
1109943863 13:69406589-69406611 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1111575900 13:90153884-90153906 CAGTCAGGGAACCAATGTGGGGG + Intergenic
1112231280 13:97591285-97591307 CAGTCAGGGAGCCAATGTGGTGG + Intergenic
1112813254 13:103243584-103243606 GTTTCAGGGAGGCACTGTGGAGG - Intergenic
1113900161 13:113792415-113792437 GGGACTGGGGCCCACTGAGGTGG - Intronic
1113961583 13:114129126-114129148 GAGTCAGGGACCCACAGGGAGGG - Intronic
1114672154 14:24417049-24417071 GGCTCACGGAGCCCCTGTGGTGG + Exonic
1114751512 14:25209858-25209880 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1114758403 14:25284980-25285002 TAGTCAGGGAGCCAGTGTGGTGG + Intergenic
1115059559 14:29172777-29172799 GAGTCAGGGATCCAATGTGGGGG - Intergenic
1115826336 14:37282391-37282413 TGGGCAGGGATCCAATGTGGTGG - Intronic
1116236444 14:42285076-42285098 GGGTCAGGGACCCACTTGAGAGG + Intergenic
1116684391 14:48019118-48019140 GGGTCAGGGACCACTTGAGGAGG - Intergenic
1116773063 14:49149430-49149452 GGGTCAGAGACCCATTGAGGAGG + Intergenic
1117001439 14:51375186-51375208 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1117216683 14:53558985-53559007 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1117596421 14:57330997-57331019 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1117633979 14:57723268-57723290 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1117832302 14:59764159-59764181 GGGTTATGGAGCCACTGTGAGGG + Intronic
1118880910 14:69825122-69825144 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1119675330 14:76549260-76549282 GGTTCAGGGCTCCACTGAGGGGG + Intergenic
1119985366 14:79131499-79131521 GGGTCAGGGACCCATTTGAGGGG + Intronic
1120556135 14:85931549-85931571 CTGTCAGGGAGCCAATGTGGGGG + Intergenic
1120778220 14:88461151-88461173 GGGTCAGGGACCCACTTGAGGGG + Intronic
1120973516 14:90229348-90229370 TAGTCAGGGAGCCAGTGTGGGGG - Intergenic
1121014386 14:90539436-90539458 GGGGCAGGTACTCAGTGTGGTGG - Exonic
1121371231 14:93360178-93360200 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1121560817 14:94873916-94873938 GGCTCTGGGACACACTGGGGAGG + Intergenic
1122806607 14:104263067-104263089 GGGACAGGGACCAGCTCTGGGGG + Intergenic
1122873563 14:104652301-104652323 GGCTCAGGGAGCCCCTGAGGAGG + Intergenic
1202846614 14_GL000009v2_random:183277-183299 GGTTCAGGGACCCACTAGGTGGG + Intergenic
1202916077 14_GL000194v1_random:173880-173902 GGTTCAGGGACCCACTAGGTGGG + Intergenic
1123758773 15:23416941-23416963 GGGTCCCGGACCTGCTGTGGTGG + Intergenic
1124853112 15:33360254-33360276 TGGGCAGGGACTGACTGTGGAGG - Intronic
1127057192 15:55143864-55143886 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1127900926 15:63340356-63340378 TGGTCAGGGACCCCCGGTAGCGG + Exonic
1128895810 15:71372719-71372741 GGGTCAGGGACCCACTTGAGGGG + Intronic
1129548769 15:76426055-76426077 GGGTCAGGGACCCACTTGAGGGG + Intronic
1129871294 15:78943515-78943537 GAGTCAGGGACCGGCTGCGGTGG - Intronic
1129901971 15:79158137-79158159 GGGTCAGGGACCTGCCCTGGTGG - Intergenic
1129931281 15:79412856-79412878 AGGTTAGGAACCCACTGTGCTGG - Intronic
1130322692 15:82853989-82854011 GGTTCAGTGACCCTCCGTGGAGG - Intronic
1130608610 15:85339890-85339912 GTGTCAGGGTCCCACTTGGGAGG - Intergenic
1132139686 15:99381973-99381995 GGGTCAGGGACCCACTTGAGGGG + Intronic
1132801638 16:1757615-1757637 GAGCAAGGGCCCCACTGTGGAGG - Intronic
1133103801 16:3494410-3494432 GGGGCATGGTGCCACTGTGGAGG + Intronic
1133306251 16:4811512-4811534 GGGTCAGGGACTGACTGGGGAGG + Intronic
1137432971 16:48433421-48433443 GGGACAGGGAGCCTCTGCGGGGG + Intronic
1137674372 16:50297037-50297059 GGGCAAGGGACCCTCTGTGTGGG - Intronic
1137812620 16:51367305-51367327 TGGTCAGGGACCGGGTGTGGTGG + Intergenic
1141429051 16:83961563-83961585 GGCTCACGGGCTCACTGTGGGGG - Intronic
1142477905 17:200531-200553 GGGACAGGGACACAGTGGGGAGG + Intergenic
1143323626 17:6084100-6084122 AGGTCTGGGAGCCACTGGGGAGG - Intronic
1143465326 17:7132680-7132702 GGGTCAGGGACCAGCTGGGCAGG - Intergenic
1143539380 17:7560212-7560234 GGGTCAGGAACCCTCAGTAGGGG - Intronic
1144576373 17:16432304-16432326 GGGGCAGGGAGCCTCTCTGGTGG - Intronic
1147375174 17:40018808-40018830 GGCTCAGGGCCCCACAGTGCTGG - Intergenic
1147604022 17:41763786-41763808 GGCTCAGGGCCCCAGGGTGGTGG - Intronic
1148673661 17:49432195-49432217 GGATCTGAGAGCCACTGTGGAGG - Intronic
1149236147 17:54593349-54593371 CAGTCAGGGAGCCAGTGTGGGGG + Intergenic
1154068320 18:11129979-11130001 TAGTCAGGGAGCCAATGTGGGGG - Intronic
1154299595 18:13181536-13181558 GTTTCAGCCACCCACTGTGGGGG - Intergenic
1154358746 18:13642075-13642097 GGCTCAGGGACCGCCTGTGACGG - Intronic
1155114283 18:22749281-22749303 GGGTCAGGGACCCACTGAGGAGG - Intergenic
1155126825 18:22886069-22886091 GGGTTAGGGACCCACTTGAGGGG - Intronic
1156537637 18:37879413-37879435 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1157036788 18:43984653-43984675 GGGTCAGGGACCCACTTGAGTGG - Intergenic
1157475205 18:48019631-48019653 GGGTTGGGGTCCCACTGGGGAGG + Intergenic
1157501465 18:48193815-48193837 GGTCCAGGGACCCATCGTGGGGG + Intronic
1159629834 18:70736535-70736557 TGGTCAGGGACCCACTTGAGGGG - Intergenic
1160015054 18:75133931-75133953 GGGTCAGGGGCACGCTGGGGGGG + Intergenic
1160285358 18:77537593-77537615 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1160385543 18:78494213-78494235 GGGACAGTGACACACTGAGGGGG - Intergenic
1160775239 19:852468-852490 GGATGAGGGACCCACACTGGTGG - Intronic
1160822089 19:1063473-1063495 GGGGCAGGGCCACAGTGTGGCGG - Intronic
1161319011 19:3632518-3632540 GCGTCAGGGCCCCACTGCGGCGG + Exonic
1161323482 19:3652078-3652100 GGGTCCGGGAGCCGTTGTGGGGG - Intronic
1161681967 19:5684661-5684683 GGTTCATGGAGCCACCGTGGTGG + Intronic
1162186981 19:8913492-8913514 GGTTCTGAGATCCACTGTGGAGG + Exonic
1162365223 19:10244501-10244523 GAGACAGAGACCCACTGTGCTGG - Intergenic
1162640964 19:12010110-12010132 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1163526500 19:17824674-17824696 CTCTCAGGGAGCCACTGTGGGGG - Intergenic
1163715746 19:18870963-18870985 TGTGCAGGGTCCCACTGTGGAGG - Intronic
1163855269 19:19696909-19696931 GGGTCAGGGTTTCACTGTGTTGG + Intergenic
1164496886 19:28773840-28773862 AAGTCAGGAACCCACTGTGCTGG + Intergenic
1165117936 19:33540274-33540296 GAGTCAGGGTCTCACTCTGGAGG + Intergenic
1166327891 19:42062400-42062422 GGGGCAGTGAACCACTGTGTGGG + Intronic
1166650727 19:44572354-44572376 GGGCCTGCGACCCAGTGTGGAGG + Intergenic
1167278102 19:48551087-48551109 GGGTCAGGGACCAACAGCTGGGG + Intergenic
1167593642 19:50416863-50416885 GGGCCGAGGACCCTCTGTGGGGG - Intronic
1167612383 19:50513757-50513779 TGGTCAGGGACTCACCGAGGCGG + Exonic
1168168361 19:54570606-54570628 AAGTGAGGGAACCACTGTGGGGG - Intergenic
927640355 2:24841795-24841817 GGGTCAGGGTCTCACTGTCTGGG - Intronic
928201781 2:29251837-29251859 GGCTCAGGGACCCAGGCTGGTGG + Intronic
930216952 2:48707369-48707391 GGGTCAGGGACCCCTTGAGGAGG + Intronic
931821965 2:65961307-65961329 TGCTCATGGACCAACTGTGGAGG + Intergenic
931889952 2:66661219-66661241 AGGTTAGGAATCCACTGTGGTGG + Intergenic
932575930 2:72962330-72962352 GGGGCAGAGCCCCAATGTGGCGG + Intronic
932907152 2:75766520-75766542 GGGTCAGGGAGTCATTGTGAAGG + Intergenic
932975640 2:76596894-76596916 CAGTCAGGGAGCCAGTGTGGGGG - Intergenic
933257556 2:80098449-80098471 GGATCAGGGACCCACTTGAGAGG + Intronic
933809662 2:86025419-86025441 TGAGCAGGGACTCACTGTGGTGG - Exonic
936944562 2:117918742-117918764 GGCTCAGGGACCAGCTGAGGTGG + Exonic
937463640 2:122110568-122110590 GGGAGAGGGACACACTGCGGAGG - Intergenic
938305489 2:130251750-130251772 GGGTCTGTGACTGACTGTGGCGG - Intergenic
938671837 2:133594235-133594257 GAGTCAGCCACACACTGTGGTGG - Intergenic
938706236 2:133930005-133930027 GGGTCAGGGAGCCTTCGTGGAGG - Intergenic
938862244 2:135381544-135381566 GGGTCAGGGACCCACGTGAGAGG - Intronic
939068920 2:137516735-137516757 TAGTCAGGGAGCCAATGTGGGGG - Intronic
939511061 2:143105288-143105310 GGGTCAGGGCCAGACTATGGAGG + Intronic
939788821 2:146547196-146547218 CAGTCAGGGAGCCAATGTGGTGG + Intergenic
940400767 2:153245303-153245325 GTGTCAGGGACCCATTGAGGAGG - Intergenic
941667864 2:168260069-168260091 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
941825764 2:169894295-169894317 GAGTCAGGGTCTCACTCTGGAGG - Intronic
943317993 2:186412779-186412801 CAGTCAGGGACCCAATGTGGGGG + Intergenic
944372161 2:198997305-198997327 GGGTCACGAATCCACTGTGGGGG - Intergenic
944393546 2:199245051-199245073 GGGTCAGGGACACACTTGAGGGG + Intergenic
945562332 2:211354312-211354334 GGGTGAGGCACTAACTGTGGTGG - Intergenic
945614987 2:212055477-212055499 GGGTCAGGTACCCACTTGAGGGG - Intronic
945628193 2:212237553-212237575 GGGTCAGGGACCCACTGAGGAGG + Intronic
946103643 2:217350871-217350893 AGGTTAGGAACCCACTGTGCTGG + Intronic
946528014 2:220541089-220541111 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
946790779 2:223298646-223298668 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
947071298 2:226290964-226290986 AAGTCAGGGACCCCATGTGGAGG + Intergenic
947859360 2:233347953-233347975 GGGTCAGGGACCCACTCTCCAGG + Intergenic
948916907 2:241039110-241039132 AGATCAGGGAGCCCCTGTGGGGG - Intronic
1168799181 20:633609-633631 GGGTCAGGGGCCTGCTGGGGTGG + Intergenic
1168832958 20:857167-857189 GAGTCAGGGGCTGACTGTGGGGG - Intronic
1171081880 20:22194793-22194815 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1171086641 20:22243883-22243905 GGGTCAGCGACACACTTAGGAGG + Intergenic
1171904329 20:30888325-30888347 GGGTCTGGGACCCACTTGAGGGG + Intergenic
1171935205 20:31268501-31268523 GGGTCAGGGACACACTTGAGGGG + Intergenic
1173456839 20:43209616-43209638 TGGTCAGGGGCCCAGTGCGGTGG + Intergenic
1173709269 20:45140355-45140377 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1173924546 20:46771104-46771126 TGGGCAGGGACCCACTGGAGAGG + Intergenic
1174172659 20:48627182-48627204 GGGTCAGGGACTCAGGGTAGGGG + Intronic
1175510976 20:59526020-59526042 GGGTCACTCACCCACTTTGGGGG - Intergenic
1175669623 20:60890756-60890778 GGGTCAGGGAGTCAGGGTGGGGG + Intergenic
1176635429 21:9188526-9188548 GGTTCAGGGACCCACTAGGTGGG + Intergenic
1176915600 21:14621823-14621845 GGGTCAGGGACCCCCTTGAGGGG - Intronic
1176998010 21:15579088-15579110 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1177002758 21:15634660-15634682 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1177810402 21:25919049-25919071 GGGTCAGGGACCACTTGAGGAGG - Intronic
1178828030 21:36032492-36032514 GGGTCACTGTCCTACTGTGGGGG + Intergenic
1179177839 21:39021693-39021715 GGGCCTGGGTCCCCCTGTGGAGG + Intergenic
1179415311 21:41193639-41193661 CAGTCAGGGAGCCAGTGTGGGGG + Intronic
1179658937 21:42862577-42862599 TGGCCAGGGACCCTCTGGGGAGG - Intronic
1180414674 22:12697937-12697959 GGGTCAGGGACCAACTAGGGGGG - Intergenic
1181048881 22:20229396-20229418 GGGTCTGGGTGCCACTGGGGCGG + Intergenic
1182304493 22:29358559-29358581 GGTTCAGGCACCCTCTCTGGAGG - Intronic
1182981111 22:34672230-34672252 AGGTCAGGGACTCAATGTGGGGG - Intergenic
1183039541 22:35166353-35166375 GGGTCAGGGACCCACTTGGGAGG - Intergenic
1183619524 22:38964526-38964548 GGGTCGGGGCCCCACAGTGGCGG + Intronic
1183673849 22:39289169-39289191 GGGTTGGAGACCCAGTGTGGTGG - Intergenic
1184603714 22:45559509-45559531 CAGTCAGGGAGCCAGTGTGGGGG + Intronic
1184628470 22:45756429-45756451 GGGTCTGGGGCCGAGTGTGGTGG - Intronic
1184702633 22:46186806-46186828 GCTTCAGGTATCCACTGTGGGGG - Intronic
1184727239 22:46354281-46354303 TGGTAAGGTCCCCACTGTGGTGG - Intronic
1185271212 22:49929952-49929974 GGGTCTGGGAACCAAAGTGGAGG - Intergenic
949638629 3:6011412-6011434 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
949816853 3:8068068-8068090 GGGTCAGGGACCCACTTGAGGGG + Intergenic
950630439 3:14278577-14278599 GGGGCAGGGACACCCTGAGGAGG + Intergenic
951471607 3:23062483-23062505 GGGTCAGGGACCCACTTGAGAGG + Intergenic
951687538 3:25361955-25361977 GGTTCAGGGACCCACTGAGGAGG + Intronic
952560926 3:34592562-34592584 GGGTGAGGGACTGACTGTAGTGG + Intergenic
953344248 3:42161756-42161778 GGGTGAGGGACCCAATGCTGAGG + Intronic
954053975 3:48006552-48006574 CAGTCAGGGAGCCAGTGTGGGGG - Intronic
954108450 3:48421394-48421416 GAGCCAGGGACACACTGTTGGGG + Intronic
955069567 3:55560858-55560880 TGATCAGAAACCCACTGTGGTGG + Intronic
955700717 3:61679591-61679613 GAGACAGGGTTCCACTGTGGTGG - Intronic
956207664 3:66771297-66771319 GGGTCAGGGACCCACTTCAGGGG + Intergenic
956941105 3:74162407-74162429 GGGTCAGGGACCCACTTAAGGGG + Intergenic
957754463 3:84468272-84468294 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
957942016 3:87017792-87017814 GGGTCAGGGTCCCACTTGAGGGG - Intergenic
959377490 3:105603958-105603980 AAGTCAGGGAGCCAATGTGGGGG + Intergenic
959997479 3:112694882-112694904 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
960732013 3:120737969-120737991 GGGTCAGGGACCCACTTGAGGGG + Intronic
960792757 3:121451730-121451752 GGGTCAGGGACCCACTTGAGGGG + Intronic
960994090 3:123329712-123329734 GGGTCAGGGAGTCTCAGTGGTGG - Intronic
963032072 3:140988255-140988277 GGGTCAGGGACCCACTTAAGGGG - Intergenic
963060250 3:141219847-141219869 AGGGCTGGGAACCACTGTGGAGG - Intergenic
963159937 3:142140836-142140858 GTGTCAGGGACCCCTTGAGGAGG + Intronic
965757278 3:172039868-172039890 GGGACAGGGACGCACTTTGGCGG - Intronic
966536986 3:181046219-181046241 GGGTCAGGGACCCACTTGAGAGG + Intergenic
967409284 3:189151195-189151217 TGTTAAGGGACCCACTTTGGAGG - Intronic
968277344 3:197450510-197450532 GGGCCAGGGCCCCTTTGTGGAGG + Intergenic
968652191 4:1764714-1764736 GGGTGGGGGATCCCCTGTGGGGG - Intergenic
968726161 4:2248730-2248752 GGATGGGGGGCCCACTGTGGCGG - Exonic
969132441 4:5001819-5001841 GGGTCAGGGACCCACTTGAGAGG + Intergenic
969376719 4:6768097-6768119 GGGGCAGGGACTCCCAGTGGAGG - Intergenic
969534396 4:7746991-7747013 GGGGCAGGGACCCACGGAAGGGG + Intergenic
969574671 4:8030010-8030032 GGTACAGGGACCCACTGGCGGGG + Intronic
970180293 4:13384504-13384526 AGGTTAGGAACCCACTGTGCTGG - Intronic
971586121 4:28407481-28407503 GGGTCAGGGACCCACTTGAGGGG - Intergenic
971979434 4:33733977-33733999 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
972376568 4:38477168-38477190 GGGTCAGGGACCCACTTGAGGGG - Intergenic
973332392 4:48923177-48923199 GGGTCAGGGACCCACTGAGGAGG + Intergenic
973867092 4:55125206-55125228 GGGTAAGGAGCCCACTCTGGAGG - Exonic
974470249 4:62309943-62309965 GGGTCAGGGACCCACTTGAGGGG - Intergenic
974747056 4:66090038-66090060 CGGTCAGGGAGCCATTGTGGGGG + Intergenic
975532996 4:75420406-75420428 GGGTCAGGGACCCACTCAAGGGG + Intergenic
975733847 4:77363156-77363178 CAGTCAGGGAGCCAATGTGGGGG + Intronic
977430617 4:96927106-96927128 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
977465849 4:97382272-97382294 CAGTCAGGGAGCCAGTGTGGGGG - Intronic
977626422 4:99193779-99193801 AAGTCAGGGAGCCAATGTGGGGG + Intergenic
977701892 4:100031010-100031032 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
977930555 4:102744922-102744944 AAGTCAGGGAGCCAGTGTGGGGG + Intronic
978188034 4:105880845-105880867 GGGTCAGGGACCTACTTGAGGGG - Intronic
978216723 4:106214038-106214060 GGGTCAGGGACCCACTTGAGGGG - Intronic
978966707 4:114749835-114749857 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
979865013 4:125743594-125743616 GGGTCAGGGATACACTGGGGTGG - Intergenic
979898543 4:126190157-126190179 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
979934104 4:126670407-126670429 GGGTCCGGGACCCACTTGAGGGG - Intergenic
979998645 4:127463625-127463647 GGGTCAGTGACCCACTTGAGGGG + Intergenic
980136998 4:128867609-128867631 GGGTTAGGGACCCACAGGAGTGG - Intronic
980206065 4:129720928-129720950 GTGTCAGGGACCCACTTGAGGGG + Intergenic
980629393 4:135413154-135413176 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
980957582 4:139444810-139444832 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
981462654 4:145030686-145030708 CAGTCAGGGAGCCAATGTGGGGG - Intronic
981834847 4:149042822-149042844 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
982310824 4:153983518-153983540 GGGTCAGGGGCCCACTTGAGGGG + Intergenic
982623494 4:157734058-157734080 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
982801709 4:159714859-159714881 GGGTCAGGGACCCACTTGAGGGG + Intergenic
983184909 4:164690453-164690475 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
983896172 4:173084299-173084321 GGATCAGGGACCCACTTGAGGGG + Intergenic
983949391 4:173622043-173622065 AGGTCAGGGACCCACTTGAGGGG + Intergenic
984892052 4:184502971-184502993 GGGGTGGGGACCGACTGTGGAGG + Intergenic
985816665 5:2132682-2132704 GGGTCAGGAACGGACTGAGGTGG - Intergenic
986086970 5:4461595-4461617 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
986181014 5:5393014-5393036 TGGACAGGGACACACTGTGATGG + Intergenic
986736931 5:10674868-10674890 GGATTAGGGACACAGTGTGGGGG - Intergenic
986747747 5:10759381-10759403 TGGACAGGGACCCGCTGTGGTGG + Intronic
986959684 5:13198080-13198102 AAGTCAGGGAGCCAATGTGGGGG - Intergenic
987482131 5:18472499-18472521 GGGTCAGGGACCCGCTTAGGAGG - Intergenic
987707113 5:21471506-21471528 TGGACAGGGACACACTGTGATGG - Intergenic
988169335 5:27633928-27633950 AAGTCAGGGAGCCAATGTGGGGG + Intergenic
989072230 5:37523178-37523200 GGGTCAGGGACCTCTTGAGGAGG - Intronic
989170917 5:38469714-38469736 GGTTCAGAGAGCAACTGTGGGGG + Intergenic
989302237 5:39907979-39908001 GGGTCAGGGACCCACTTGAGGGG - Intergenic
989307631 5:39975678-39975700 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
989486525 5:41997491-41997513 CAGTCAGGGAGCCAGTGTGGGGG + Intergenic
991387557 5:66106615-66106637 GGGTCAGGGACCCACTTGAGGGG - Intergenic
991543713 5:67758234-67758256 GGGTCAGAGACCCCTTGAGGAGG - Intergenic
992242727 5:74788322-74788344 CAGTCAGGGAGCCATTGTGGGGG - Intronic
992348115 5:75901534-75901556 GGGTCAGGGACCCACTTGAGGGG + Intergenic
993119192 5:83754128-83754150 GGGTCAGAGACCCACTTGAGGGG - Intergenic
993370362 5:87085105-87085127 GGGTCAGGGACCACTTGAGGAGG - Intergenic
993410412 5:87566999-87567021 GGGTCAGGGACCCACTTAGTGGG + Intergenic
994143496 5:96367266-96367288 GTGTCAGGGACCCACTTGAGGGG + Intergenic
994805084 5:104435981-104436003 GGGTCAGACAGCCACTGTTGGGG + Intergenic
994897702 5:105726287-105726309 GGGTCAGGCACCAGCTGTGCTGG + Intergenic
996825417 5:127676711-127676733 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
997431530 5:133844323-133844345 GGGTGAGGGGCCCCCTGTGCAGG - Intergenic
997797802 5:136828455-136828477 GGGTCTGGGACCCACTTCAGGGG + Intergenic
998290476 5:140909668-140909690 CAGTCAGGGAGCCAATGTGGGGG + Intronic
999075702 5:148793291-148793313 GTCTCAAGGAACCACTGTGGGGG + Intergenic
999351240 5:150873735-150873757 CAGTCAGGGAGCCACTGTGGGGG - Intronic
999947205 5:156610484-156610506 GGGTCAGGGACCCACTTGAGGGG + Intronic
999959098 5:156735260-156735282 GGGTCAGGGACCTTCTGTGCTGG + Intronic
1005743632 6:28815671-28815693 GGGTCAGGCACCTGCTGAGGAGG - Intergenic
1005806079 6:29475603-29475625 GAGACAGAGACCCACTGTGTCGG + Intergenic
1006606338 6:35259991-35260013 GGGGCAGGGACCCTGGGTGGGGG - Intronic
1007260123 6:40557505-40557527 GGGTCAGGGAGACTCTGTGGAGG + Intronic
1008400141 6:51054367-51054389 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1008865482 6:56204646-56204668 GGGTCAGGGACCCACTGTGGAGG - Intronic
1009021114 6:57949002-57949024 TGGACAGGGACACACTGTGATGG + Intergenic
1009056480 6:58342184-58342206 GGGTCAGGGATCCACTTGAGGGG + Intergenic
1009234705 6:61108414-61108436 GGGTCAGGGGCCCACTTGAGGGG - Intergenic
1009305841 6:62088676-62088698 GGGACAGGGACCCACTTGGGGGG + Intronic
1009628708 6:66167165-66167187 GGGTCAGGGACCGACTTGAGGGG - Intergenic
1010484326 6:76391207-76391229 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1010790013 6:80053816-80053838 GGCTCAGGGACCCACTTGAGGGG + Intergenic
1010818480 6:80387280-80387302 CAGTCAGGGAGCCAATGTGGAGG - Intergenic
1011039503 6:83014399-83014421 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1011040044 6:83019888-83019910 GAGTCAGGGAGGGACTGTGGCGG + Intronic
1011174160 6:84541480-84541502 GGGTCAGGGACTCACTTGAGAGG - Intergenic
1011782237 6:90802390-90802412 GGGTCAGGCAAACAATGTGGAGG + Intergenic
1012730317 6:102873200-102873222 CAGTCAGGGAGCCAGTGTGGGGG - Intergenic
1014357734 6:120433267-120433289 GGATCAGGGACCCACTTGAGGGG - Intergenic
1016576400 6:145573706-145573728 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1017227963 6:152042202-152042224 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1018145505 6:160883532-160883554 AGGTCAGGGATTCACTGAGGAGG - Intergenic
1019002983 6:168770968-168770990 CAGTCAGGGAGCCAGTGTGGGGG - Intergenic
1020101986 7:5399100-5399122 GGGGCAGGGGGGCACTGTGGGGG - Intronic
1020396569 7:7724423-7724445 CTGTCAGGGAGCCAATGTGGGGG - Intronic
1020710193 7:11596496-11596518 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1020735936 7:11949691-11949713 AGGTTAGGAACCCACTGTGCTGG + Intergenic
1021022107 7:15614167-15614189 GAGACAGGGTCCCACTGTGTTGG - Intronic
1023066012 7:36378549-36378571 GGTTCAGGGACCCACTTGAGGGG + Intronic
1023233038 7:38053812-38053834 GTGGCAGGGACCCACAGTGGGGG + Intergenic
1024016042 7:45315967-45315989 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1024040028 7:45545823-45545845 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1024044930 7:45579805-45579827 GAGTCAGGAGCACACTGTGGGGG - Intronic
1024264245 7:47594665-47594687 GGGTCAGACACACACTCTGGTGG - Intergenic
1024817450 7:53287799-53287821 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1024884492 7:54125765-54125787 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1026819879 7:73539951-73539973 GGCTCAGGGACTCACTCTGCTGG + Exonic
1027146766 7:75700990-75701012 GGGTCAGGGGCCGGGTGTGGTGG - Intronic
1028078699 7:86547732-86547754 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1028946396 7:96585290-96585312 GGGTCAGGGACCCATTGAGGAGG + Intronic
1029312267 7:99678276-99678298 GGGTCCTGGCCCCACCGTGGAGG - Intronic
1029314417 7:99698365-99698387 GGGTCCTGGCCCCACAGTGGAGG - Intronic
1029320056 7:99750861-99750883 GGGTCCTGGCCCCACAGTGGAGG - Intergenic
1029562065 7:101309116-101309138 GGGTCAGGGACCCAGCCTGTGGG + Intergenic
1029705696 7:102274674-102274696 GGGTCAGGGCCCCAAGGTGGGGG - Intronic
1029980456 7:104873936-104873958 GGGGCAGGGGCCCACACTGGAGG + Intronic
1030067324 7:105669968-105669990 TGGTCAGGGATTCACTCTGGAGG + Intronic
1030570583 7:111217376-111217398 GGGTCAGGTACCCACTTAAGCGG - Intronic
1030698977 7:112617948-112617970 GGGTCACTGAGACACTGTGGAGG + Intergenic
1032153254 7:129448069-129448091 CAGTCAGGGAGCCACTGTGGGGG + Intronic
1032603646 7:133326650-133326672 GGGTCAGGGACCCACTTGAGGGG + Intronic
1033015727 7:137669403-137669425 GGGGCAGGGACCCACAGTACTGG - Intronic
1033076111 7:138251938-138251960 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1033887576 7:145967248-145967270 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1034466248 7:151231660-151231682 TGGTTGGGGAACCACTGTGGTGG + Intergenic
1035519520 8:266034-266056 GGGTCAGTGTCCCCCTGGGGAGG + Intergenic
1035735672 8:1885829-1885851 GGGCCAGGAACCTACAGTGGAGG - Intronic
1035998256 8:4573596-4573618 GGGTCAGGGTCCCACTTGAGGGG + Intronic
1037398373 8:18467554-18467576 GGGTCAGGGACCTACTTGAGGGG - Intergenic
1038311570 8:26449519-26449541 GGGAGAGGGACCCACTGCGTAGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1038975406 8:32690318-32690340 GGGTAAGGGACTTGCTGTGGGGG - Intronic
1040373307 8:46798011-46798033 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1040678919 8:49785896-49785918 GAGTTAGGGAACCAATGTGGGGG - Intergenic
1040779964 8:51095635-51095657 GGGTCAGGGACCCACTTGAGAGG - Intergenic
1041459678 8:58098017-58098039 GGGTCAGGGACCCACTTGAGGGG + Intronic
1041934404 8:63320202-63320224 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1042394551 8:68276986-68277008 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1042946244 8:74157171-74157193 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1044378077 8:91499833-91499855 GGGTCAGGGACTCACTTAGGAGG + Intergenic
1044487298 8:92768245-92768267 CAGTCAGGGAGCCAGTGTGGGGG + Intergenic
1045143498 8:99313610-99313632 GGGTCATGGACCCACTTGAGGGG + Intronic
1045975036 8:108122500-108122522 GGGTCAGAGACCAATTGAGGAGG + Intergenic
1046417790 8:113938933-113938955 CAGTCAGGGAGCCAGTGTGGGGG + Intergenic
1046585919 8:116148756-116148778 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1047358203 8:124143245-124143267 AGGTCAGCGACCCACAGTGGTGG - Intergenic
1048093188 8:131262779-131262801 GGGTCAGGGACCCACTTGAGGGG - Intergenic
1048327728 8:133451981-133452003 GGATCAGGGAGCCAGCGTGGTGG + Intergenic
1048984889 8:139730075-139730097 GGGCCAGCTGCCCACTGTGGCGG + Intergenic
1049216858 8:141412289-141412311 CTGACAGGGTCCCACTGTGGAGG + Intronic
1050482523 9:6101500-6101522 TAGTCAGGGAGCCAATGTGGGGG - Intergenic
1051445547 9:17135456-17135478 GGGTCCCGGCCCCGCTGTGGTGG - Intronic
1051881995 9:21849535-21849557 CAGTCAGGGAGCCAGTGTGGGGG - Intronic
1052052662 9:23866078-23866100 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1052227457 9:26107250-26107272 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1054825377 9:69567784-69567806 GGGTCCGGGACATCCTGTGGGGG + Intronic
1055807868 9:80116966-80116988 GGGTCAGGGACCCACTGAGGAGG + Intergenic
1056176718 9:84043555-84043577 GTGTCAGGGACCCACTTGAGGGG + Intergenic
1056230231 9:84535885-84535907 GGGTCTGGGACCCACTTGAGGGG + Intergenic
1057260599 9:93580948-93580970 GGGGCAGGGAGCCAGTGAGGAGG + Intronic
1058019745 9:100074955-100074977 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1058072807 9:100619085-100619107 GGGTCAGGGACCCACTTGAGAGG + Intergenic
1060589480 9:124807965-124807987 AGGTCAGGGACCCCCGGAGGTGG + Exonic
1061443952 9:130626998-130627020 GAGTCACGGACTCTCTGTGGAGG + Intronic
1203758206 Un_GL000218v1:155832-155854 GGTTCAGGGACCCACTAGGTGGG + Intergenic
1186469920 X:9813210-9813232 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1187477548 X:19625577-19625599 GGGTCAGGACATCACTGTGGTGG - Intronic
1191003758 X:55688579-55688601 GTGTCAGGGACCCACTTCGGGGG + Intergenic
1191017712 X:55827774-55827796 GGATCAGGGACCCACTTGAGGGG - Intergenic
1191237947 X:58151281-58151303 GGGTCAGGGTCCCACTCTGCTGG - Intergenic
1191946220 X:66537889-66537911 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1192196976 X:69034897-69034919 GGGTCGGGAACACATTGTGGAGG + Intergenic
1192834310 X:74782828-74782850 GGGTAAGGGAGGCAGTGTGGTGG + Intronic
1192884212 X:75320028-75320050 GGGTCAGGGGCCCACTTGAGGGG + Intergenic
1193154325 X:78157327-78157349 GGGTCAGGGACCCACTTGGGAGG + Intergenic
1193685497 X:84572144-84572166 GGGTCAGGGACCACTTGAGGAGG - Intergenic
1193832798 X:86308989-86309011 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1193844803 X:86455493-86455515 TGGTCTGGGACCCTCTGAGGGGG - Intronic
1193983114 X:88208570-88208592 GGGTCAGGGACCCAGTTGAGGGG - Intergenic
1194576288 X:95618392-95618414 GGATCAGGGACCCCCTTGGGGGG + Intergenic
1195437778 X:104865066-104865088 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1195809804 X:108816942-108816964 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1195847908 X:109248484-109248506 AGGTCAGGGACCCACTTGAGGGG + Intergenic
1197008880 X:121536654-121536676 GGGTCAGGGACCCACTTGAGGGG + Intergenic
1197097320 X:122611709-122611731 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1197245202 X:124160121-124160143 CAGTCAGGGAGCCAATGTGGGGG + Intronic
1197477516 X:126942454-126942476 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1197591721 X:128418265-128418287 CAGTCAGGGAGCCAATGTGGGGG - Intergenic
1198783191 X:140258921-140258943 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1198933870 X:141886728-141886750 CAGTCAGGGAGCCAATGTGGGGG - Intronic
1199144587 X:144350088-144350110 CAGTCAGGGAGCCAATGTGGGGG + Intergenic
1199449949 X:147968092-147968114 GGGTCAGGTACCCACTTGAGGGG - Intergenic
1200060001 X:153479933-153479955 GGGTCTGTGAGCCACTTTGGAGG - Intronic
1200066962 X:153508563-153508585 GGGTCAGGGACCCGAGGTGGGGG - Exonic
1200751938 Y:6954116-6954138 GGGTCAGGGACCCACTTGAGGGG + Intronic
1201397455 Y:13564591-13564613 GGGTCAGGGACCCACTTGAGAGG + Intergenic
1201522203 Y:14887972-14887994 GGGTCAGGGACCCCTTTGGGAGG + Intergenic
1201916772 Y:19190556-19190578 GGGTCAGGGGCCCACTTGAGGGG + Intergenic
1201957764 Y:19645175-19645197 GGGTCAGGGACCCACTTGAAGGG + Intergenic