ID: 1008868032

View in Genome Browser
Species Human (GRCh38)
Location 6:56238657-56238679
Sequence AGGTATCTGCTGAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 595
Summary {0: 1, 1: 0, 2: 9, 3: 203, 4: 382}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008868032_1008868042 25 Left 1008868032 6:56238657-56238679 CCTGCCACCTTCAGCAGATACCT 0: 1
1: 0
2: 9
3: 203
4: 382
Right 1008868042 6:56238705-56238727 CCCAAGTACTAGGTGGATAATGG 0: 1
1: 0
2: 1
3: 5
4: 63
1008868032_1008868038 18 Left 1008868032 6:56238657-56238679 CCTGCCACCTTCAGCAGATACCT 0: 1
1: 0
2: 9
3: 203
4: 382
Right 1008868038 6:56238698-56238720 TCCCTCTCCCAAGTACTAGGTGG 0: 1
1: 0
2: 0
3: 11
4: 148
1008868032_1008868037 15 Left 1008868032 6:56238657-56238679 CCTGCCACCTTCAGCAGATACCT 0: 1
1: 0
2: 9
3: 203
4: 382
Right 1008868037 6:56238695-56238717 AGTTCCCTCTCCCAAGTACTAGG 0: 1
1: 0
2: 0
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008868032 Original CRISPR AGGTATCTGCTGAAGGTGGC AGG (reversed) Intronic
900210669 1:1454330-1454352 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900216542 1:1485001-1485023 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900223623 1:1522729-1522751 GTGTCTCTGCTGCAGGTGGCTGG + Exonic
900923764 1:5690434-5690456 AGGTATGTGCTGAGAGTGGCTGG - Intergenic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
901930940 1:12595797-12595819 AGGTGGCTGCAGAAGGGGGCTGG + Intronic
902729827 1:18362153-18362175 TGGTAGCGGCTGAAGGGGGCTGG - Exonic
902984749 1:20148650-20148672 GGGTCTCTCCTGAGGGTGGCCGG + Exonic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904371127 1:30048013-30048035 AGTTCTCTGCTGAAGGTCACCGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906457308 1:46008188-46008210 ATGTAGCTGCTGAAGATGGTGGG + Intronic
907545718 1:55258360-55258382 AGTTTGCTGCTGAAGATGGCTGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910561899 1:88599979-88600001 GGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910630219 1:89346250-89346272 AGTTATCTGCAAAAGATGGCAGG - Intergenic
910677085 1:89825754-89825776 AGATGTCTTCTGAAGCTGGCAGG + Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911044458 1:93617134-93617156 ATGTGTCTGCTGAATATGGCTGG - Intronic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911664196 1:100535546-100535568 AAGTTCCTGCTGAAGGTGGGAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912500905 1:110121346-110121368 AGGTAGCTACTGTCGGTGGCTGG + Intergenic
912733324 1:112128831-112128853 AGTCATCTGCAGAAGATGGCAGG + Intergenic
913671184 1:121098143-121098165 AGGGATCTGATGCAGCTGGCGGG + Intergenic
914022954 1:143885564-143885586 AGGGATCTGATGCAGCTGGCGGG + Intergenic
914661441 1:149793508-149793530 AGGGATCTGATGCAGCTGGCGGG + Intronic
914898788 1:151700086-151700108 AGGTATCTGCTGTTGGGGGTGGG + Intergenic
916106331 1:161435329-161435351 AGTTATTTGCAGAAGATGGCAGG + Intergenic
916827043 1:168452473-168452495 AGGGAACTAGTGAAGGTGGCAGG + Intergenic
916931876 1:169586861-169586883 AGCCATCTGCTTAAGGTGGTTGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
919833844 1:201560392-201560414 AGGGATATGCTGATGGTGGAGGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921945061 1:220880356-220880378 AGGTCTTTGCTGGAGGGGGCCGG - Exonic
922203182 1:223424208-223424230 GGGTGTCTCCTGAAGGTGGGAGG + Intergenic
922223691 1:223627490-223627512 AGGCATCTGCTGAGGCTTGCTGG + Intronic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063017503 10:2093592-2093614 ACGTTTCTGCTGAAGGTGACTGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065405515 10:25358960-25358982 AGGTATCTGCTAAATCTGGTTGG + Intronic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067222637 10:44355180-44355202 CGGTTTCTGCTGATGGAGGCTGG - Intergenic
1068007719 10:51409878-51409900 AGTTATCTGCAGAAGATGTCAGG + Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069666388 10:70163300-70163322 AGATAACTGATGAAGGTGGGTGG + Intronic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071003432 10:80856322-80856344 AGCTATCTGAGGAAGGTGCCTGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071597045 10:86935936-86935958 AGGCATCTTCACAAGGTGGCAGG + Exonic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072922505 10:99588258-99588280 AGGTTTCTGTTGAGGGCGGCAGG + Intergenic
1073290478 10:102410850-102410872 AGGGAGCTGCTCAAGGTGGGGGG - Exonic
1073498058 10:103912067-103912089 AGGCATGAGCTGAAGATGGCAGG + Intronic
1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1076213662 10:128674590-128674612 AGGTATCTGCCCAGGGTGGATGG + Intergenic
1076691656 10:132226750-132226772 AGGTACCTGCTGAGGTGGGCGGG - Intronic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077256112 11:1584144-1584166 AGGCATTTGCTGCAGGTGGCTGG + Intergenic
1080076590 11:28157493-28157515 AGTTATCTGCAGAAGATGTCAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081110475 11:39128391-39128413 AGTTATCTGCATAAGATGGCAGG - Intergenic
1081209775 11:40318477-40318499 AAGTATCTGTAGAAGGTAGCAGG - Intronic
1081609059 11:44547850-44547872 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082699348 11:56408874-56408896 AGGTATCTTAACAAGGTGGCAGG - Intergenic
1082999658 11:59279854-59279876 TAGTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083367826 11:62152124-62152146 GTGTTTCTGCTGCAGGTGGCAGG + Exonic
1083470554 11:62881219-62881241 GAGGAGCTGCTGAAGGTGGCAGG + Exonic
1083779139 11:64909214-64909236 AGGGTTCTGCTGGGGGTGGCAGG - Intronic
1084473806 11:69377665-69377687 TGGTATCTGCTGCAGGGTGCAGG - Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085747569 11:79128212-79128234 AGTTATCTGCAGAAGATGCCAGG - Intronic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088449352 11:109965340-109965362 AGTTATCTGTGGAAGATGGCAGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089270610 11:117299377-117299399 AGTGATCTGCTCAAGGTGACAGG - Intronic
1090209495 11:124908075-124908097 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092274208 12:7046966-7046988 AGGAATGTGCTGAGGATGGCAGG + Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093031873 12:14295977-14295999 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095284645 12:40393982-40394004 TGGTGGCTGCTGAAGGTGGTGGG + Intronic
1095724651 12:45438222-45438244 AAATATGTGCTGAATGTGGCAGG - Intronic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096504310 12:52082923-52082945 AAGAATGGGCTGAAGGTGGCAGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1098131739 12:67358316-67358338 AGGTAAAAGATGAAGGTGGCCGG - Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099023064 12:77430801-77430823 AGGTAGTTGGTGAATGTGGCTGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100083302 12:90878185-90878207 AGTTATCTGCAGAAGATGTCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1104730164 12:131100967-131100989 AGGTATTTGCTGAAGGCGTCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108267723 13:48729263-48729285 AGGTGTCTGATGGAGGTGGAGGG - Intergenic
1108302439 13:49092012-49092034 TGTTATCTGCGGAAGATGGCAGG + Intronic
1108904275 13:55449944-55449966 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1109589577 13:64460450-64460472 AGGTACATGATGAAGGAGGCTGG + Intergenic
1109914047 13:68956168-68956190 AGTAATCTGCTGATGTTGGCTGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1110834138 13:80064656-80064678 TGTTATCTGCAGAAGATGGCAGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1113319708 13:109221690-109221712 CGTTATCTGCAGAAGATGGCAGG + Intergenic
1113484043 13:110641781-110641803 AGGCACCTGCAGGAGGTGGCGGG + Intronic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114406501 14:22462031-22462053 AGGGATCTGCTGAAGGTAGGTGG - Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116158382 14:41236692-41236714 AGCTATCTGCAGAAGGTGACAGG + Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116415069 14:44669285-44669307 AGTTATTTGCAGAAGATGGCAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1120555997 14:85930472-85930494 AGTTATCTGCATAAGATGGCAGG + Intergenic
1120630597 14:86885384-86885406 AGGTAGCTGCTGGAGTTGGCAGG - Intergenic
1120849166 14:89153742-89153764 AGGTAACAGTTGAAGATGGCAGG + Intronic
1121700293 14:95948182-95948204 AGCTATCTGGGCAAGGTGGCTGG + Intergenic
1122077907 14:99247397-99247419 AGCCAGCTGCTGAAGGTGGCAGG + Intronic
1122163679 14:99804960-99804982 TGGTAGCTTCTGAAGGTGCCAGG + Intronic
1122695654 14:103550939-103550961 AGGTGGCGGCTGCAGGTGGCTGG - Intergenic
1122741591 14:103874738-103874760 GGGTGTCTGCAGAAGGAGGCTGG + Intergenic
1125675075 15:41497565-41497587 AGGTATCTCCCTAAGGTGGAAGG + Intronic
1126283607 15:46986250-46986272 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1128809980 15:70563699-70563721 AGGTAAGTGCTGAAGCTGGAAGG - Intergenic
1129888738 15:79057132-79057154 AGGCATCTGCTGAGGGTTGGGGG - Intronic
1130910337 15:88266326-88266348 GGGCATGTGCTGAGGGTGGCAGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139337756 16:66245072-66245094 AAATATGTGGTGAAGGTGGCAGG - Intergenic
1141322185 16:83021576-83021598 AGGTTTCTGCTGAAGATTGTTGG + Intronic
1141440865 16:84028882-84028904 AGGTGTCCGCTCAAGGTGGTGGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141785697 16:86198987-86199009 GGCTATTTTCTGAAGGTGGCAGG + Intergenic
1141907570 16:87037540-87037562 AGTTAGCTGCTCATGGTGGCAGG - Intergenic
1142746815 17:1963504-1963526 AGGGAGCCCCTGAAGGTGGCGGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1147218184 17:38912929-38912951 AGGTCTCTGATGGAGGTAGCAGG + Intronic
1147635821 17:41963206-41963228 AGGTATCTGCAGAGGGTCTCAGG - Intronic
1148165724 17:45482890-45482912 AGGCTGCAGCTGAAGGTGGCAGG + Intronic
1148368246 17:47072731-47072753 AGGCTGCAGCTGAAGGTGGCAGG - Intergenic
1150396951 17:64829614-64829636 AGGCTGCAGCTGAAGGTGGCAGG + Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1152055352 17:78021122-78021144 AGGTAGCTGAAGAAGGAGGCTGG + Intronic
1152473169 17:80501463-80501485 GGGTGTCTGGTGAAGGTGCCAGG - Intergenic
1152610628 17:81313563-81313585 AGTTCTCTCCTGACGGTGGCAGG - Exonic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153920706 18:9786608-9786630 TGGTATCTGCTGCTGGTGGTGGG + Intronic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155979030 18:32161811-32161833 AGGTTTGTGCTGCAGTTGGCTGG - Intronic
1156520431 18:37717718-37717740 AGGGTTCTGTAGAAGGTGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157341198 18:46779996-46780018 AGTTATCTGGAGAAGATGGCAGG - Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160359191 18:78256363-78256385 AGGCATCTTCACAAGGTGGCAGG + Intergenic
1162859413 19:13494857-13494879 AGGGACCTGGTGAAGGTGACTGG - Intronic
1163649636 19:18509756-18509778 AGGCATTTGCTGAAGGTGGGTGG - Intronic
1164028855 19:21381822-21381844 TGGTTACTGCTGAAGGTGTCAGG + Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1165314978 19:35049275-35049297 TGGTGTCTGTTGCAGGTGGCCGG + Exonic
1166890249 19:45987389-45987411 CTGCATCTGCTGAACGTGGCCGG + Intergenic
1167116750 19:47493013-47493035 AAGTGTCTGCTGAAGGTGGCTGG - Exonic
1167421122 19:49404002-49404024 AGGTTACTGCAGAAGGAGGCAGG + Intronic
1167693843 19:51002712-51002734 AGATCTCTGGTGAAGGAGGCGGG + Exonic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
926810399 2:16750706-16750728 TAGTATCTGCAGAAGATGGCAGG + Intergenic
926825569 2:16902261-16902283 GGTTATCTGCAGAAGATGGCAGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928281361 2:29949248-29949270 AGATGGCTGCTGAAGGAGGCAGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930544604 2:52750667-52750689 AGGTTTCTGCTCAGGGTGGAGGG - Intergenic
930910148 2:56620868-56620890 AGTTATCTGCAGAAGATGCCAGG - Intergenic
932500606 2:72179760-72179782 ATGTACCTGCTGTAGGTGTCTGG + Intronic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933741570 2:85538520-85538542 ATGGCTCTGCTGAAGATGGCCGG - Intergenic
935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935638429 2:105268613-105268635 AGGGATATGCTGAAGGAGGTGGG + Intronic
936601941 2:113905222-113905244 TGGTAACTGCTGAGGCTGGCAGG + Intronic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938173939 2:129107137-129107159 AGGTATCTCCTGCAGATGGTGGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939788688 2:146546142-146546164 AGTTATCTGCAGAAGATGCCAGG + Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
940282344 2:152000941-152000963 AAGAATCTGCTGGAGGTGGGAGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942302913 2:174579729-174579751 AGGGCTCTGTTGAAGGAGGCTGG - Intronic
943006893 2:182395812-182395834 AGTTATCTGGAGAAGATGGCAGG - Intronic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943384066 2:187181119-187181141 AGCTATCTGTGGAAGATGGCAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946448455 2:219759756-219759778 AGCAATCTGCTCAAGGTGGGTGG - Intergenic
946502805 2:220267563-220267585 AGGCAACTGCTGGAGCTGGCTGG + Intergenic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948345597 2:237294983-237295005 AGGTAGATACTGAAGTTGGCAGG + Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1172107124 20:32523404-32523426 AGATGCCTGCTGAAGGTTGCAGG - Intronic
1172451070 20:35023331-35023353 AGGGATATACTGAAGGTGCCTGG + Intronic
1172861457 20:38056541-38056563 ATGTATCTGCAGCAGGTGCCTGG + Intronic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177194952 21:17894387-17894409 AGGTCACTTCTGAAGGTGGTAGG + Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178370207 21:32021121-32021143 AGGTGTCTGAAGAAGGTTGCAGG - Intronic
1178942499 21:36917847-36917869 AGGTAACAGCTGGAGGTGACTGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1179726255 21:43343065-43343087 ACGTATCGGATAAAGGTGGCTGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1181832700 22:25574635-25574657 AGGTATTTGGTGGTGGTGGCGGG + Intronic
1182063980 22:27417393-27417415 AGGTATTTGCTGAAGGAAGGAGG + Intergenic
1183243104 22:36672927-36672949 AGTTATGTGTTGAAGGAGGCTGG + Intronic
1183736080 22:39645693-39645715 AGCTATCTGCTCAGGCTGGCCGG + Intronic
1184507463 22:44913201-44913223 AGATGTCTCCTGAAGGTGCCTGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949638777 3:6012487-6012509 AGTTATCTGCAAAAGATGGCAGG - Intergenic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
954054115 3:48007647-48007669 AGTTATCTGTAGAAGATGGCAGG - Intronic
954845663 3:53553444-53553466 AGGCATTTGCTGGTGGTGGCAGG + Intronic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959377348 3:105602864-105602886 AGTTATCTGCGGAAGATGGTAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959520449 3:107317787-107317809 AGGCACCTGTAGAAGGTGGCTGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960342863 3:116496939-116496961 AGGTACCTGTAGGAGGTGGCTGG - Intronic
960694919 3:120386725-120386747 AGGTATGTGCTGAGGGCTGCTGG + Intergenic
960710478 3:120522610-120522632 AAAAATCAGCTGAAGGTGGCTGG + Intergenic
960867237 3:122214035-122214057 AGGTGACTGCTGAAAGTGCCTGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
963504455 3:146165969-146165991 AGGTCTCTGCTGCAGATGTCAGG + Intergenic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964656240 3:159068983-159069005 AGGTATCTAGGGAAGCTGGCTGG + Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965291744 3:166889610-166889632 AGTTATATGCAGAAGATGGCAGG + Intergenic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966971492 3:185049376-185049398 AGGTCTCTGCTCTAGGTGGTTGG - Intronic
968223731 3:196958992-196959014 AGGCATCTGCTGAGGGTGAGTGG + Intronic
968228784 3:196992211-196992233 AGGGATGTGCTGATGGAGGCTGG + Intronic
968349239 3:198038953-198038975 GGGTTGCTGATGAAGGTGGCTGG - Exonic
968349247 3:198038994-198039016 GGGTTGCTGATGAAGGTGGCTGG - Exonic
968733333 4:2282154-2282176 TGGCAGCTGCAGAAGGTGGCTGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
968906942 4:3457937-3457959 AGTTATCTGCGGAAGATGGCAGG - Intergenic
969533231 4:7740833-7740855 AGGTAGCTGCTGGCGGTGGTGGG + Exonic
969745390 4:9066896-9066918 AAGTTTTTGCTGAAGGTGGATGG - Intergenic
969874666 4:10127198-10127220 AGGTCTAGGCTTAAGGTGGCGGG + Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971105940 4:23524457-23524479 AGGCATCTGTAGGAGGTGGCTGG - Intergenic
971626600 4:28928311-28928333 ATGTATCTGGTGCAGGTGTCAGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971918840 4:32910238-32910260 AGGCACCTGCAGGAGGTGGCTGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
971985951 4:33824183-33824205 AGAAATATGCTGAAGCTGGCAGG + Intergenic
972201301 4:36717183-36717205 AGTTATCTGTAGAAGATGGCAGG + Intergenic
972759934 4:42093131-42093153 AATTATCTGGTCAAGGTGGCAGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
976034208 4:80795851-80795873 AGTTATTTGCAGAAGATGGCAGG + Intronic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977337380 4:95716128-95716150 AGTTATCTGCGGAGGGTGTCAGG + Intergenic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978134296 4:105238267-105238289 TGGTAGTTGCTGAAGGTTGCTGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979767017 4:124474565-124474587 AGTTATCTGTAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980629520 4:135414256-135414278 AGTTATATGCAGAAGATGGCAGG - Intergenic
980957729 4:139445887-139445909 AGTTATCTGCAGAAGATGTCAGG - Intergenic
982033432 4:151323879-151323901 AGCTTTCTGCTGAAGGTAACAGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982623345 4:157732931-157732953 GGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988169205 5:27632867-27632889 AGCGATCTGCAGAAGATGGCAGG + Intergenic
988188771 5:27901207-27901229 GGTTATCTGCAGAAGATGGCAGG - Intergenic
988562127 5:32290818-32290840 CGTTATCTGCAGAAGATGGCAGG - Intronic
988766410 5:34382267-34382289 AGTTATCTGCAAAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989486387 5:41996388-41996410 AGTTATCTGCAAAAGATGGCAGG + Intergenic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991561299 5:67956244-67956266 AGGTAGCTGGTCAAGGTGTCAGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992195104 5:74331248-74331270 AGGTTTCTGCTGAAGGCCTCTGG - Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992654539 5:78895525-78895547 AGGTATCAGGTGAAGAAGGCAGG - Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993812673 5:92501837-92501859 AGGCATATGCTGATGGTGGTTGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995269560 5:110205495-110205517 AGCTATGTGCAGAAGATGGCAGG + Intergenic
995427736 5:112043755-112043777 AGTTATTTGCAGAAGATGGCAGG + Intergenic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997267172 5:132501616-132501638 AGGTAACTGCTGAGCGAGGCTGG + Intergenic
997601574 5:135142104-135142126 AGGTATCAGCTGCAGGAGGCAGG + Intronic
997702830 5:135916363-135916385 AGTTATATGCTGAAGATGGTTGG + Intergenic
997762951 5:136467874-136467896 AGGTATCTACTTTAGGTGGTAGG + Intergenic
998966331 5:147544741-147544763 AGCCATCTGATGAAGGTAGCAGG - Intergenic
1000084356 5:157876421-157876443 AGGTAACTGCTGATGGATGCTGG - Intergenic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002425213 5:179170888-179170910 AGGTGTCTGATGAACGTGGGAGG - Intronic
1002522049 5:179797482-179797504 AGGTCGCTGCTGATGCTGGCTGG + Intergenic
1002892605 6:1348611-1348633 AGGTTTCTGCTGCACCTGGCTGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003695901 6:8406168-8406190 AGTCATCTGCAGAAGATGGCAGG + Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005493052 6:26364306-26364328 TGGTATCTGCTTGAGATGGCTGG - Intergenic
1005521217 6:26602213-26602235 CAATAACTGCTGAAGGTGGCTGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1007135015 6:39512435-39512457 AGGTATGGGCTGCAGGTGGGAGG - Intronic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1008868032 6:56238657-56238679 AGGTATCTGCTGAAGGTGGCAGG - Intronic
1009308634 6:62122274-62122296 GGTTATCTGCAGAAGATGGCAGG - Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010431699 6:75784824-75784846 AAGTATCAGCTGAAGATTGCGGG + Intronic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012730458 6:102874291-102874313 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013406668 6:109849774-109849796 AGTTATCTGTAGAAGATGGCAGG - Intergenic
1013497799 6:110715781-110715803 AAGTTTCTGCCGAAGATGGCAGG - Intronic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014631638 6:123796773-123796795 AGTTGTCTGCAGAAGATGGCAGG - Intergenic
1015095453 6:129409629-129409651 AGTGATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016940418 6:149478800-149478822 AGGTATGGGGTGAAGATGGCAGG - Intronic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018330887 6:162727160-162727182 AGGCACCTGGTGAGGGTGGCTGG - Exonic
1018599881 6:165527498-165527520 AGTTATCTGGTGGAGATGGCAGG - Intronic
1018607966 6:165618499-165618521 TGGTTTCTCCTGAAGGTGGGCGG - Intronic
1018735105 6:166681797-166681819 AGGCACCTGCTGCAGGTGTCAGG - Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018867300 6:167756128-167756150 AGGGCTCATCTGAAGGTGGCCGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1023656136 7:42422828-42422850 AGGAAGCTGCTGAAATTGGCAGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024087753 7:45910617-45910639 AGGTATTTACTGGAAGTGGCAGG + Intergenic
1024866099 7:53906315-53906337 AGTTATCTGAAAAAGGTGGCAGG - Intergenic
1025030058 7:55549563-55549585 AGCCATCTGCTGCAGGTGGCCGG + Intronic
1026046492 7:66909127-66909149 AGTTATATGCAGAAGATGGCAGG + Intergenic
1026929311 7:74215180-74215202 AGGGCACTGCTGCAGGTGGCTGG - Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030368750 7:108673998-108674020 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1030931292 7:115525712-115525734 AGTTATCTGCGGAAGATGGCAGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1036225212 8:6952048-6952070 AGGAATCTGCTGTAGGGGCCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1040911943 8:52528388-52528410 TGTTATCTGCAGAAGATGGCAGG - Intergenic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042489597 8:69381907-69381929 ATGTACCTGCAGGAGGTGGCTGG - Intergenic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046063987 8:109175192-109175214 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1046585788 8:116147749-116147771 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1047422507 8:124718680-124718702 AGATATTTGCAGAAGGAGGCTGG - Intronic
1047916820 8:129592254-129592276 AGGCAGCTGCTCAAGGGGGCGGG - Intergenic
1048099600 8:131336031-131336053 AGGCATCTTCACAAGGTGGCTGG + Intergenic
1048601639 8:135924496-135924518 AAGTATCAGATGAAGGTGGGAGG - Intergenic
1048626159 8:136187667-136187689 CTGTATCTGCAAAAGGTGGCAGG + Intergenic
1049196202 8:141317004-141317026 AGGCTGCTGCTGAGGGTGGCTGG + Intergenic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050808464 9:9714718-9714740 AGTTCTCTGCTGATGGTGGGAGG + Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052301745 9:26959735-26959757 AGTCATCTGCTGAGAGTGGCAGG + Intronic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052979121 9:34434789-34434811 AGGTATCTGCTCAATGTTGATGG + Intronic
1055807585 9:80114169-80114191 AGGGATCAGCTGAAGGTGGAAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057173382 9:92976912-92976934 AGGTCACTGCTCAAGGTGTCAGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058376281 9:104325623-104325645 AGGTATTTGCTGAAGGTTTTTGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1060767756 9:126307826-126307848 GGGAATCTGCTGATGGGGGCCGG + Intergenic
1061550356 9:131331101-131331123 ATGTGGCTGGTGAAGGTGGCTGG - Intergenic
1061654648 9:132079617-132079639 AGGTACCGGCTGAAGGGGCCGGG - Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186469770 X:9812139-9812161 AGTTGTCTGCAGAAGATGGCAGG + Intronic
1186546344 X:10453842-10453864 AGGTATATGCTGAAGATCACAGG - Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188633215 X:32394623-32394645 AGGTATCTGCTGAGGATGAGAGG + Intronic
1189154887 X:38746752-38746774 AGTTATTTGCAGAAGATGGCAGG + Intergenic
1190688403 X:52894071-52894093 AGGTAACTGAGGAAGGTGACAGG - Intronic
1190697580 X:52961721-52961743 AGGTAACTGAGGAAGGTGACAGG + Intronic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193053487 X:77125736-77125758 AGTTTTCTGCAGAAGATGGCAGG - Intergenic
1193447152 X:81618739-81618761 AGTTATCTGCAGGAGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194833955 X:98658772-98658794 AGTTATCTGCAGAAGGTCCCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195066337 X:101241651-101241673 AGGTATCTGCAAGAGGAGGCAGG - Exonic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197380003 X:125727937-125727959 AGTTTTCTGCAGAAGATGGCAGG + Intergenic
1197409326 X:126096447-126096469 AGTTATATGCAGAAGATGGCAGG + Intergenic
1197521993 X:127510339-127510361 AGTTATCTGTAGATGGTGGCAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199144445 X:144348997-144349019 AGGTATCTGAAGAAGATAGCAGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200709922 Y:6474113-6474135 AGGTGTCTGCAAAAGATGGCTGG + Intergenic
1201024193 Y:9690595-9690617 AGGTGTCTGCAAAAGATGGCTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201798423 Y:17926667-17926689 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1201803130 Y:17979290-17979312 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202359743 Y:24095357-24095379 GGTTATCTGCAGAAGATGGCAGG - Intergenic
1202511035 Y:25574757-25574779 GGTTATCTGCAGAAGATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic