ID: 1008875981

View in Genome Browser
Species Human (GRCh38)
Location 6:56328411-56328433
Sequence TGCCATACCACTAGTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008875981_1008875983 14 Left 1008875981 6:56328411-56328433 CCCATCACACTAGTGGTATGGCA 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1008875983 6:56328448-56328470 ACCTATACTAAACAACTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008875981 Original CRISPR TGCCATACCACTAGTGTGAT GGG (reversed) Intronic
906588885 1:47004924-47004946 TCCCATTCCACTAGTGATATAGG - Intergenic
909341316 1:74534561-74534583 TGCCATCTCTCTAGTGTGGTGGG - Intronic
918713768 1:187764386-187764408 TGCCAAACCACTATGGAGATGGG + Intergenic
921404580 1:214765004-214765026 TGTCCTACCACTGCTGTGATGGG - Intergenic
923470861 1:234289527-234289549 TGCCATAACGCTGGTCTGATAGG - Intronic
1064112065 10:12548115-12548137 TCCTTTACCACTTGTGTGATGGG + Intronic
1069830666 10:71280459-71280481 TGCCATATCATTATTGTGAATGG - Intronic
1079430248 11:20382765-20382787 TGGAATAGGACTAGTGTGATGGG - Intronic
1083006497 11:59351502-59351524 TGCCCTGCCACTATTGTGGTGGG - Intergenic
1089212749 11:116817095-116817117 TGCCACAGAACTAGAGTGATGGG + Intergenic
1099819048 12:87686175-87686197 TGCAATCCCTCTGGTGTGATAGG - Intergenic
1102738311 12:115182796-115182818 TGTCATACAACTAGAGTGAGGGG + Intergenic
1104475161 12:129065010-129065032 TGCAATACCACTGGTATGTTGGG - Intergenic
1112905634 13:104416940-104416962 TGTCATAGCACTACAGTGATGGG + Intergenic
1116243572 14:42379227-42379249 TGACCTGCCACTACTGTGATGGG + Intergenic
1132695082 16:1198440-1198462 TCCCGCACCCCTAGTGTGATCGG - Intronic
1147129811 17:38400626-38400648 TGCCATCCCACTTCTGGGATGGG + Exonic
1155961653 18:32000599-32000621 TGACATTCCACTATTGTGATTGG + Intergenic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1161712523 19:5857294-5857316 TGACATCCCACCATTGTGATTGG + Intergenic
1162707009 19:12562673-12562695 TGACAAACCTCTAGTGGGATGGG - Intronic
1165765780 19:38350137-38350159 TGACATTCCACTAGTGAGAAGGG + Intronic
933329236 2:80876083-80876105 TGACATTCCACCACTGTGATTGG - Intergenic
940906594 2:159175210-159175232 TGCTGTACCACTACTGAGATGGG - Intronic
941695295 2:168544638-168544660 GTCCATACCAGCAGTGTGATCGG - Intronic
944877000 2:203972446-203972468 TGCCCTACCCCTGGTGTGACTGG + Intergenic
948214370 2:236217507-236217529 GGGAATACCAATAGTGTGATAGG - Intronic
1173063284 20:39682410-39682432 TGCCACATCACTGGAGTGATTGG + Intergenic
1178575701 21:33787943-33787965 TGCCATACCAGTAGGCTGCTTGG + Intronic
1182059832 22:27388861-27388883 TGCTATACCCCCACTGTGATGGG - Intergenic
1183280906 22:36931948-36931970 TGCAATCCCACCAGTGTGATGGG - Intronic
955424618 3:58775421-58775443 TGCAATCACACTAGTGTGAAAGG - Intronic
957702859 3:83740607-83740629 TGCCATCCCAATACTGTGCTTGG + Intergenic
960588743 3:119345384-119345406 TGCCATAACCCCAGTGTGCTGGG - Intronic
964429242 3:156587481-156587503 TGCCAGACCACTAGTTTACTAGG + Intergenic
976997099 4:91447498-91447520 TGCTATAATAGTAGTGTGATAGG - Intronic
978440856 4:108731930-108731952 ACCCATACCACTAGGGTGAGAGG - Intergenic
983492087 4:168399809-168399831 TGCCATACCAATCGTATGCTTGG - Intronic
984468909 4:180140186-180140208 AGCCTAATCACTAGTGTGATAGG - Intergenic
984557231 4:181228965-181228987 AGCAAAACCATTAGTGTGATGGG + Intergenic
990373503 5:55145603-55145625 CTCCAAACCACCAGTGTGATGGG - Intronic
991244379 5:64493756-64493778 TGACATACCTCTGTTGTGATGGG - Intergenic
991406355 5:66304335-66304357 TCCCAAACCACTAGGGTTATAGG + Intergenic
993476549 5:88373397-88373419 TGCCATAACATTAGTTTTATGGG - Intergenic
993920632 5:93796353-93796375 TGGTATAGCACTAATGTGATTGG + Intronic
994341369 5:98632620-98632642 TCCCATATCACTTCTGTGATGGG - Intergenic
999062265 5:148648621-148648643 TGCCATACTAGTTGTGTGATAGG + Intronic
1002208555 5:177581515-177581537 TGCCATACCACTAGAATGAGCGG - Intergenic
1003150817 6:3547631-3547653 TGACATTCCACCATTGTGATTGG + Intergenic
1004090374 6:12494537-12494559 CGCCATACCACCATTGTCATGGG + Intergenic
1008875981 6:56328411-56328433 TGCCATACCACTAGTGTGATGGG - Intronic
1009489888 6:64276002-64276024 AGCTATAACAGTAGTGTGATTGG - Intronic
1013742150 6:113299860-113299882 CTCCATACTACTTGTGTGATTGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029278920 7:99424496-99424518 TGCCATACCTCTAGAGTGTTGGG + Intronic
1041874770 8:62675533-62675555 TGGCATACCACTGGTGTGGGTGG - Intronic
1050675954 9:8053399-8053421 GGCCACACCACTATTGTCATTGG - Intergenic
1056301362 9:85245149-85245171 TTCCATCCCAACAGTGTGATTGG + Intergenic
1187282508 X:17868696-17868718 AGCCAGACCACCAGTGTGTTGGG + Intergenic
1191151094 X:57221445-57221467 TGGCATACTACTTCTGTGATAGG - Intergenic
1195909025 X:109870724-109870746 TGACATTCCACCATTGTGATTGG - Intergenic