ID: 1008876317

View in Genome Browser
Species Human (GRCh38)
Location 6:56333292-56333314
Sequence CCTAGGAAGGGGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 1, 1: 0, 2: 12, 3: 129, 4: 1091}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008876317 Original CRISPR CCTAGGAAGGGGAGGGTGGG AGG (reversed) Intronic
900055883 1:630372-630394 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900310818 1:2032428-2032450 CCCAGGAAGCAGAGGGTAGGAGG - Intergenic
900316885 1:2061396-2061418 TGGAGGAAGGGGAGGTTGGGGGG + Intronic
900605397 1:3521484-3521506 CCTGGGATGGGGAGGGTGTTGGG - Intronic
900626459 1:3610901-3610923 CAAAAGAAGGGGAGAGTGGGAGG + Intronic
901026693 1:6282163-6282185 CCCAGGCCGGGGAGGGTGGTGGG - Intronic
901082709 1:6592655-6592677 CCCGGGAAGGAGAGGGTGAGAGG + Exonic
901167497 1:7230627-7230649 CCAAGGAGGTGGAGGGTGGAGGG + Intronic
901292219 1:8132931-8132953 CCTTGGAAGGCTAAGGTGGGAGG + Intergenic
901298698 1:8182249-8182271 CCTAGAAAGAGGAGGGAGAGCGG - Intergenic
901321400 1:8342431-8342453 CCTAGGCCTGGGAGAGTGGGAGG - Intronic
901529532 1:9844412-9844434 CCAAAGATGGGGAGGCTGGGAGG - Intergenic
901694605 1:10997498-10997520 CCTAGGAGGGGGAGGGGAGAGGG + Intergenic
901788293 1:11639082-11639104 CCTATGATTGAGAGGGTGGGAGG - Intergenic
901826414 1:11864676-11864698 CTAAGCAAGGGGAGGGAGGGAGG - Intergenic
902283041 1:15388324-15388346 CCTGGGGAGGGGAGGGAGGGAGG - Intronic
902648230 1:17819050-17819072 CCTGGGAGGAGGAGGCTGGGAGG - Intronic
902754878 1:18542372-18542394 CCTAGGAGGGGGATGGGGAGCGG + Intergenic
903243355 1:21998807-21998829 TCTGGGAAGGAGAGGGAGGGCGG - Intergenic
903291224 1:22315465-22315487 CGCAGGAAGGGGAGGCTGCGGGG + Intergenic
903811191 1:26035914-26035936 CCTAGGAATGGGTGGCGGGGTGG - Exonic
904038615 1:27571719-27571741 CCTGGGAGGGGGAGGGGAGGGGG - Intronic
904282981 1:29434313-29434335 CCTGGGAATGGGGGGGTGGAAGG - Intergenic
904296439 1:29522362-29522384 CCTAGGAGGAGGAAGCTGGGTGG - Intergenic
904372443 1:30058412-30058434 CAGGGGAAGGGGAGGGAGGGTGG - Intergenic
904641935 1:31937918-31937940 TCGGGGAAGGGGAGGGCGGGAGG - Intronic
905030912 1:34884160-34884182 CTTTGGAAGGCCAGGGTGGGTGG - Intronic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905508299 1:38498158-38498180 CCTGAGAGGTGGAGGGTGGGGGG - Intergenic
905649996 1:39649960-39649982 CCTAGGAAGGAGGGGGTGTTAGG + Intergenic
905725744 1:40250438-40250460 ACTAGGGAGGGTAAGGTGGGAGG - Intronic
905777607 1:40679284-40679306 CCTGGGGAGGGGATGGTGGGAGG - Intergenic
906146782 1:43565274-43565296 CCTAGCGAGGGGAGGGTCGGGGG - Intronic
906313389 1:44769781-44769803 CCTTGGTAGGGTAAGGTGGGAGG + Intergenic
906544203 1:46609967-46609989 CCTTGGTAGGGGAGGGTGGTAGG + Intronic
906646364 1:47478218-47478240 CCCAGGAATGTGAGGGAGGGAGG - Intergenic
906662199 1:47590819-47590841 GCTGGGCAGGGCAGGGTGGGTGG + Intergenic
907126658 1:52056435-52056457 TGTCGGAAGGGGAGGGCGGGGGG - Intronic
907302758 1:53498796-53498818 GCTAGGAAGGAAAGGGTGGGAGG - Intergenic
907420285 1:54342518-54342540 CCTGGGAATGGGAGGGGGTGGGG - Intronic
907437737 1:54460159-54460181 CCTTGGATGGGGAAGGAGGGAGG + Intergenic
907644621 1:56229751-56229773 CATAGGAAGAGGAGAGGGGGTGG + Intergenic
907860254 1:58345884-58345906 CCCAGGACGGGGAGGGAGGCAGG - Intronic
908062700 1:60369143-60369165 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
908199513 1:61779894-61779916 GCGAGGAAGTGGTGGGTGGGGGG + Intronic
908295393 1:62707647-62707669 CATGGGAAGTGGAGGGTGGCAGG + Intergenic
908574929 1:65449453-65449475 CGCAGGAAGGGTAGGCTGGGAGG + Intronic
908645241 1:66271381-66271403 ACTTTCAAGGGGAGGGTGGGTGG - Intronic
908865635 1:68546365-68546387 ACTTGGAAGGCTAGGGTGGGAGG + Intergenic
909131051 1:71738040-71738062 CCTAGGAAGGAGTGGGAGGAAGG - Intronic
909994320 1:82260421-82260443 ACTTGGAGGGGGAGGGTGGGAGG + Intergenic
910216129 1:84846950-84846972 CCTAGAAATGGGAGGGTATGAGG + Intronic
911017106 1:93345634-93345656 TCTGGGAAGGGGTGGGTGGCTGG - Intergenic
911317305 1:96370722-96370744 GCAAGGAAGTGGGGGGTGGGGGG - Intergenic
911520822 1:98927789-98927811 CCTAAGAAGTGGAGGGTTGGAGG - Intronic
911627492 1:100141573-100141595 CTTTGGAAGGGTAAGGTGGGAGG - Intronic
912308513 1:108595569-108595591 GGGAGGAAAGGGAGGGTGGGAGG + Intronic
912328012 1:108787211-108787233 ACTAGGGAGGCAAGGGTGGGGGG - Intronic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912988520 1:114459240-114459262 CCTAGGAAGGGAAGGGCTGAAGG + Intronic
913053015 1:115133519-115133541 CTTAGGAAGGGGTGGGAGGGAGG - Intergenic
913395792 1:118370404-118370426 CCTAGAGAGAGGAGGGAGGGAGG - Intergenic
914066124 1:144247745-144247767 CCTGGGACTGTGAGGGTGGGGGG - Intergenic
914113029 1:144718609-144718631 CCTGGGACTGTGAGGGTGGGGGG + Intergenic
914696182 1:150082428-150082450 CCTGGGAGGCGGAGGTTGGGAGG + Intronic
914813465 1:151046629-151046651 CCTAGGAGAGGGAGAGGGGGAGG - Exonic
914930301 1:151925237-151925259 CCTAGGAAGGGTAGGAGGGGTGG + Intergenic
915298788 1:154940401-154940423 GAGAGGAAGTGGAGGGTGGGGGG + Intergenic
915339312 1:155167564-155167586 CCTAGGGCGGGGAGGGGGGAAGG - Intergenic
915386989 1:155503964-155503986 CTTAGGGAGGCCAGGGTGGGTGG - Intronic
915511929 1:156391254-156391276 CCCTGCCAGGGGAGGGTGGGTGG + Intergenic
915551541 1:156638277-156638299 CCCAGGCAGGAGGGGGTGGGGGG - Intergenic
915759505 1:158296173-158296195 CCTATGGTGGGCAGGGTGGGGGG - Intergenic
915762642 1:158330422-158330444 CCCAGCAAGAGGAGGGTGCGGGG + Intronic
916127666 1:161585764-161585786 GCTAGATGGGGGAGGGTGGGAGG + Intronic
916137584 1:161667568-161667590 GCTAGATGGGGGAGGGTGGGAGG + Intronic
916382793 1:164231620-164231642 GCTGGTAAGGGGAGGGTGGTGGG + Intergenic
917348839 1:174056490-174056512 CACAGGAATGGGAGGGAGGGTGG + Intergenic
917470280 1:175320766-175320788 AGAAGGAAGGGGAGGGAGGGAGG - Exonic
917638383 1:176958833-176958855 CATGGGATGGGGACGGTGGGAGG - Intronic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918312047 1:183291971-183291993 CCCAGGAAGAGCGGGGTGGGCGG - Intronic
918326675 1:183417500-183417522 CCTAGGACGGGGAGGGGGCCGGG - Intronic
918539141 1:185608821-185608843 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
919061461 1:192639183-192639205 CCTGGCAAGGGGAGTGTGGTTGG + Intronic
919221643 1:194638277-194638299 CCTGGAAGGCGGAGGGTGGGAGG - Intergenic
919693071 1:200544735-200544757 GTGAGGAAGGGGAGGGAGGGAGG + Intergenic
920165331 1:204031635-204031657 CCAAGGAGGGGCAGGGAGGGAGG + Intergenic
920170357 1:204068297-204068319 TCTAGGAAGAGGAGGGTTTGGGG + Intergenic
920334441 1:205235186-205235208 CCTAGGCTGGAGGGGGTGGGGGG - Intronic
920640684 1:207749103-207749125 CTTATGAAGGGCAGTGTGGGTGG - Intergenic
921070931 1:211656949-211656971 CATGGGAAGGGGAGGTTGGGTGG - Intergenic
921086522 1:211798932-211798954 CCTAGAAAAGAGAGGGAGGGAGG + Intronic
921233298 1:213096443-213096465 CTTTGGGAGGGCAGGGTGGGTGG + Intronic
921983354 1:221282990-221283012 TCTAGGTAGGGGAAGGGGGGAGG - Intergenic
922707049 1:227795408-227795430 CGTGGGAAGGAGAGGGTGGGGGG - Intergenic
922707107 1:227795556-227795578 CGTGGGAAGGAGTGGGTGGGGGG - Intergenic
922749186 1:228062790-228062812 CCTAGGAAGTGGATAGTGAGGGG - Intergenic
922860829 1:228814939-228814961 CTCAGAAAGGGGAGGGCGGGAGG - Intergenic
922977687 1:229798933-229798955 ACTAGAAAGGGGAGAGTGGGAGG + Intergenic
923402361 1:233627605-233627627 CCTCGCAGTGGGAGGGTGGGCGG + Intronic
923657054 1:235926242-235926264 CTCAGAAAGGGGAGGATGGGAGG - Intergenic
924250083 1:242123854-242123876 ACTGGGAAGGTGAGGGTGGGTGG + Intronic
924459202 1:244243324-244243346 CCTGGGAAGCGGAGGTTGTGGGG + Intergenic
924463204 1:244277689-244277711 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
924508170 1:244705475-244705497 GCCAGGGAGTGGAGGGTGGGAGG - Intronic
1062984292 10:1753176-1753198 AGTAGGCAGGGTAGGGTGGGAGG + Intergenic
1063048441 10:2418255-2418277 CCTGGGAAGGGGAGGGGAAGTGG - Intergenic
1063233212 10:4086507-4086529 CCTAGGAAGGAGAAGGTTTGTGG - Intergenic
1064139514 10:12778631-12778653 CCTTGGAAGGCCAGGGTGAGAGG + Intronic
1064304309 10:14151727-14151749 CCTGGGGAAGGGAGGGAGGGAGG - Intronic
1064636331 10:17371539-17371561 CCTTGGAAGGGAGAGGTGGGAGG + Intronic
1064870718 10:19933853-19933875 GGAAGGAAAGGGAGGGTGGGAGG + Intronic
1065077682 10:22097692-22097714 CCAAGGATGGGGAGGGAGGGAGG - Intergenic
1065786518 10:29220685-29220707 CCTAGGGAGGGAAGGAAGGGGGG - Intergenic
1066418989 10:35246997-35247019 CCCTGGAAGGGATGGGTGGGTGG + Intergenic
1066697987 10:38095224-38095246 GGTAAGAAGGGAAGGGTGGGGGG + Intronic
1067040603 10:42951457-42951479 CCCATGAGGCGGAGGGTGGGGGG - Intergenic
1067233622 10:44428335-44428357 AGGAGGAAGGGAAGGGTGGGAGG + Intergenic
1067345517 10:45435414-45435436 TCCAGGAAGGGGAGGGAGGGAGG - Intronic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1068510784 10:57963391-57963413 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1069021217 10:63490489-63490511 CCTAGGAGGCGGAGGTTGCGGGG - Intergenic
1069237570 10:66096630-66096652 ACTAGGAAGGGTAAGGTGGGAGG - Intronic
1069513535 10:69059537-69059559 CTTTGGAAGGCCAGGGTGGGAGG - Intergenic
1070259903 10:74844971-74844993 CCTTGGGAGGCCAGGGTGGGAGG + Intronic
1070460122 10:76658067-76658089 CCTAGATGGGGGAGGGTGGAAGG + Intergenic
1070543839 10:77437292-77437314 AAAAGGAAGGGGAGAGTGGGAGG + Intronic
1070713613 10:78701610-78701632 CCTAGGAAGGGGCTAGTGGTTGG - Intergenic
1070716726 10:78727850-78727872 GTTTGGAGGGGGAGGGTGGGTGG - Intergenic
1070830952 10:79417835-79417857 CCTTGGAATGGGAGGGAGTGGGG + Intronic
1071123684 10:82309988-82310010 AGTAGGAAGGGGAGTGTGGTTGG - Intronic
1072075829 10:91972381-91972403 TTTAGGAAGGTGAGAGTGGGAGG - Intronic
1072089322 10:92111662-92111684 CCTAGGATGGGGAAGCTGGAGGG + Intronic
1072574498 10:96687783-96687805 ACTAGGAAGGGAAGGAAGGGTGG - Intronic
1072598284 10:96896665-96896687 CTTTGGAAGGGCAGGGCGGGTGG - Intronic
1072690211 10:97567830-97567852 CCTGGGGAGGGGAGGGGAGGGGG + Intronic
1072730075 10:97840305-97840327 GTTAGGAAAGGGAGGGAGGGAGG + Intergenic
1073146456 10:101284880-101284902 ACTATGTAGGGGAGGATGGGTGG - Intergenic
1073326631 10:102647092-102647114 CACAGGCAGGGGTGGGTGGGTGG + Intronic
1073859339 10:107719577-107719599 GCTAAGAATGGGAGGGTTGGTGG + Intergenic
1073917959 10:108428022-108428044 CATATGAGGGGGAGGGAGGGAGG - Intergenic
1074873997 10:117600337-117600359 CCTAGGTAGGGGAGGGGAGGAGG + Intergenic
1074925260 10:118062500-118062522 TGTAGGAAGGAGAGGGTGGGTGG - Intergenic
1075367985 10:121909801-121909823 CTTTGGGAGGCGAGGGTGGGAGG + Intronic
1075923058 10:126229137-126229159 CCTGGGAAGGGGAGGCTCTGAGG - Intronic
1075953428 10:126501905-126501927 CTCAGAAAGGGGAGGGTGAGAGG + Intronic
1076138889 10:128064187-128064209 CACAGGAAGGGCAGGCTGGGAGG + Intronic
1076259555 10:129054771-129054793 CCTCGGGAGGGGACGGTGGGTGG - Intergenic
1076417685 10:130303110-130303132 CCTTGGGAGGCGAAGGTGGGAGG - Intergenic
1076682497 10:132180412-132180434 CCCAGAAAGGGGAGGGTGGGTGG + Intronic
1076736727 10:132462338-132462360 CTGAGGAGGGGGCGGGTGGGGGG + Intergenic
1076850834 10:133091903-133091925 CCCAGGAAGGGGAGTCTCGGAGG + Intronic
1077065234 11:638104-638126 CCAGGGGAGGGGAGGGTGTGTGG + Intronic
1077142210 11:1029658-1029680 GCCAGGGAGGGGAGAGTGGGAGG - Intronic
1077243094 11:1521671-1521693 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
1077490535 11:2858995-2859017 GGTAAGGAGGGGAGGGTGGGCGG - Intergenic
1077556793 11:3229915-3229937 CCTTGGGAGGGGATGGAGGGAGG - Intronic
1077581403 11:3419502-3419524 CCTAGGATGGGCTGGCTGGGTGG + Intergenic
1077609899 11:3637594-3637616 CCTAGGAGGGTGAGGGTGGGGGG + Intergenic
1078181485 11:9015315-9015337 CCAAGGCAGGGGAGTGTGGTAGG + Intergenic
1079135502 11:17774119-17774141 CCCAGGAAGGGAAGGGTATGCGG - Intronic
1079332202 11:19542872-19542894 CCCAGGAAGGGGAGGGTTTCAGG - Intronic
1079345344 11:19646934-19646956 CCTAGGAGAGGGAGTATGGGAGG - Intronic
1079495073 11:21033382-21033404 ACTTGGAGGTGGAGGGTGGGAGG - Intronic
1080121605 11:28684435-28684457 CCAAGGGAGGGGATGGTGGAGGG + Intergenic
1080652740 11:34235570-34235592 CACAGGAAGGGGAGCGGGGGAGG + Intronic
1080831299 11:35895645-35895667 CTTTGGAAGGGCAAGGTGGGCGG + Intergenic
1080896795 11:36454547-36454569 CGTAGGCAGCGGAGGGTGTGGGG + Intronic
1081047804 11:38297667-38297689 CATAGGAAGTGAAGGGTGTGGGG - Intergenic
1081194749 11:40147892-40147914 CCTATCAGGGTGAGGGTGGGAGG - Intronic
1081592147 11:44431116-44431138 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
1081656927 11:44863459-44863481 CCTGGGAAGGGGAGTTTTGGAGG + Intronic
1081682828 11:45020673-45020695 CCTGTGAATGGGTGGGTGGGAGG - Intergenic
1081838139 11:46174908-46174930 ACTTGGAAGGCCAGGGTGGGAGG - Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1081976738 11:47240082-47240104 CCTAGGAGGTGGAGGGAAGGGGG + Exonic
1081996679 11:47369831-47369853 CCTAAGAAAGGGTGTGTGGGAGG - Intronic
1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG + Intronic
1082274320 11:50205593-50205615 CCCAGGAAGTGGAGGTTGGAGGG - Intergenic
1082774404 11:57234607-57234629 CCTTGGCAGGGGGTGGTGGGGGG - Exonic
1082783284 11:57302782-57302804 CCTGGGAGCCGGAGGGTGGGGGG + Exonic
1082836402 11:57653995-57654017 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
1083026882 11:59558617-59558639 CCTAGGAAGAGTGGGCTGGGTGG - Intergenic
1083192378 11:61061596-61061618 CCTAGGGTGGGGCGGGAGGGAGG - Intergenic
1083297451 11:61722695-61722717 CCTGGGAGGCGGGGGGTGGGGGG + Intronic
1083318181 11:61828876-61828898 CCGAGGAAGGGGAGGACGCGTGG - Intronic
1083384913 11:62300465-62300487 CCAAGGAGGGGGAGGGTTGGTGG + Intergenic
1083593746 11:63909479-63909501 CAAAGGAAGGGGAGGGTGGATGG + Exonic
1083719437 11:64597177-64597199 CCTGGGAAGGGCAGTTTGGGCGG - Intronic
1083775668 11:64893361-64893383 CCTAGGACAGGGAGGGCGGCAGG + Intergenic
1083776262 11:64895599-64895621 CCTAGGAAGGGGAGGAAGAGTGG - Intronic
1083801567 11:65049094-65049116 CCCAGGAAGTTGAGGGTGTGGGG - Intronic
1083841866 11:65309193-65309215 TCCAGGAAGGAGAGGCTGGGAGG + Intergenic
1084065922 11:66704545-66704567 CCTTGGGAGGTGGGGGTGGGGGG - Intronic
1084178802 11:67436639-67436661 CCGGGGGAGGGGAGGATGGGAGG - Intronic
1084197113 11:67529735-67529757 CTTTGGAAGGCCAGGGTGGGCGG + Intergenic
1084238313 11:67802339-67802361 CCTAGGATGGGCTGGGTGGGTGG + Intergenic
1084637043 11:70399122-70399144 CCAAGGAAGGTGGGTGTGGGGGG + Intronic
1084780437 11:71404691-71404713 CCTTGGAAGGGGCGTGAGGGTGG + Intergenic
1084803592 11:71564017-71564039 GCTAGAAAGAGGAGGGTGGCTGG + Intronic
1084834099 11:71790493-71790515 CCTAGGATGGGCTGGGTGGGTGG - Intronic
1084995736 11:72976521-72976543 CTTTGGAAGGCGGGGGTGGGAGG - Intronic
1085233699 11:74994610-74994632 GCCAGGAAGGTGTGGGTGGGGGG - Exonic
1085592587 11:77778098-77778120 CTTGGGAAGGGGAGGGGAGGAGG + Intronic
1086372251 11:86166667-86166689 ACTAGAAGGTGGAGGGTGGGAGG + Intergenic
1086737902 11:90329870-90329892 GCGAGGAAGGGGAGGAGGGGAGG - Intergenic
1087378382 11:97372345-97372367 ACCAGGAAGTGGAGGGTGGGTGG + Intergenic
1087853370 11:103059741-103059763 CCGAGGAGTGGGGGGGTGGGGGG + Intergenic
1088352795 11:108909194-108909216 CCCTGGAAGGGAAGGGTGGCTGG + Intronic
1088396831 11:109378355-109378377 CCTAGGCAGGAAAGGGTGGGTGG + Intergenic
1088572154 11:111232914-111232936 CCTTGGAAGGCCAAGGTGGGCGG - Intergenic
1088645662 11:111914129-111914151 GCTGGGATGGGGAGGGAGGGAGG + Intronic
1088751754 11:112847944-112847966 CCTAGCAAGGTGGGGGTGGAGGG - Intergenic
1088930280 11:114344340-114344362 CTTTGGAAGGGCAAGGTGGGAGG + Intergenic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089077677 11:115751389-115751411 CCTAGGAAGGATGAGGTGGGAGG - Intergenic
1089150299 11:116358759-116358781 CCAAGGCAGGGGAGGTGGGGAGG - Intergenic
1089223316 11:116893967-116893989 TCTAGGAAGGTGAGGGTGTGGGG + Intronic
1089254818 11:117188686-117188708 CCTGGAAAGGGCAGGGAGGGAGG - Exonic
1089300423 11:117495439-117495461 ACTAGGCAGGGAGGGGTGGGTGG + Intronic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089540222 11:119185415-119185437 CCTGGGAGGGGATGGGTGGGAGG + Intergenic
1089615557 11:119692852-119692874 CCCAGGAAGGGGAGAGAGGGAGG - Intronic
1090357060 11:126147210-126147232 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1091228134 11:133970429-133970451 CTTAGGCAGTGGAGGGTCGGGGG - Intergenic
1091306525 11:134539802-134539824 CCTAGGAGGGTGAGAGTGGAAGG + Intergenic
1091727268 12:2854848-2854870 CCTGGGCAGGGCAGGCTGGGTGG + Intronic
1092408997 12:8239971-8239993 CCTAGGATGGGCTGGGTGGGTGG + Intergenic
1092484757 12:8893022-8893044 CCTGGGAAGGGCAGGGAGTGTGG - Intergenic
1092549107 12:9478391-9478413 CTTGGGAAGGGGTGGGAGGGTGG + Intergenic
1092608567 12:10147714-10147736 ACTAGAAGGGGGAGGGAGGGAGG - Intergenic
1092617820 12:10231688-10231710 CATAGGGAGGGGGCGGTGGGGGG - Intergenic
1092776077 12:11946191-11946213 ACTGGGAAGGGAAGGGAGGGAGG + Intergenic
1092986615 12:13851929-13851951 CAGAGGAGGAGGAGGGTGGGTGG + Intronic
1093106942 12:15098238-15098260 ACAAGAATGGGGAGGGTGGGAGG - Intergenic
1093591495 12:20907385-20907407 AGAAGGAAGGGGAGGGAGGGAGG - Intronic
1093932979 12:24972634-24972656 CATAGGCAGAGCAGGGTGGGAGG - Intergenic
1094128180 12:27045558-27045580 CCTGGGCAGAGGTGGGTGGGTGG + Intronic
1094503888 12:31044076-31044098 CTTGGGAAGGGGTGGGAGGGTGG - Intergenic
1095391025 12:41706850-41706872 GCTAGAGTGGGGAGGGTGGGAGG - Intergenic
1095781451 12:46064783-46064805 CCTAGGAAGGCTAAGGTGGGAGG + Intergenic
1095797047 12:46231288-46231310 CCAAAGAAGGGGAAGGTGGGAGG + Intronic
1096472810 12:51889727-51889749 CCCAGGAAGGAAAGTGTGGGAGG + Intronic
1096476324 12:51911419-51911441 TCTAGGAAAGGGTGGGTGGAGGG - Intronic
1096702084 12:53391745-53391767 ACTAGATAGGGGAGGGTCGGGGG - Intronic
1096809207 12:54159075-54159097 CCTAGGGTGAGGAGGGTGTGGGG - Intergenic
1096856931 12:54489897-54489919 CCTTGGAAGGCCAAGGTGGGAGG - Intergenic
1096950012 12:55458642-55458664 ACTTGAGAGGGGAGGGTGGGTGG + Intergenic
1097180847 12:57171048-57171070 TCTGTGAAGGGGAGGGTGAGGGG + Intronic
1097186453 12:57198920-57198942 CCAAGGAGGGTGGGGGTGGGAGG + Intronic
1097590623 12:61570623-61570645 CCTAGGAAGGGGTGGAAAGGAGG + Intergenic
1098791800 12:74833574-74833596 CTGAGGAATGGGGGGGTGGGAGG + Intergenic
1099439820 12:82686768-82686790 TCCAGGCCGGGGAGGGTGGGAGG + Intergenic
1099961621 12:89402517-89402539 ACTAGAGAGTGGAGGGTGGGAGG - Intergenic
1100286285 12:93169617-93169639 GAAAGGAAGGGGAGGGAGGGAGG + Intergenic
1100397150 12:94195257-94195279 CCCAGGAAGGGTGGGGTGGGAGG - Intronic
1100505206 12:95213333-95213355 CCTTGGGAGGGCAAGGTGGGAGG + Intronic
1100618296 12:96248562-96248584 CCTAGGAGTGGGACTGTGGGCGG + Intronic
1100679857 12:96907348-96907370 CTTAGGATCGGGAGGGTGCGCGG - Intronic
1101202870 12:102455053-102455075 CCCAGGAATGGCACGGTGGGTGG - Intronic
1101413194 12:104486075-104486097 CCCAGGCAGGGAAGGCTGGGAGG - Intronic
1101816900 12:108152330-108152352 CCTGAGCAGGGCAGGGTGGGAGG + Intronic
1101819566 12:108173479-108173501 TGAAGGCAGGGGAGGGTGGGGGG - Intronic
1102112087 12:110372210-110372232 TCAAGGAAGGGGATGGTGGGAGG + Intergenic
1102505895 12:113384455-113384477 CCTAGGAAGGGGTGCCTTGGTGG + Intronic
1102637560 12:114337348-114337370 ACTAGAGAGGGGAGGGAGGGAGG - Intergenic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1102709641 12:114914808-114914830 CCAAGGAAAGGGAGGCTCGGGGG + Intergenic
1102907426 12:116687608-116687630 CCTTGGAAGGGTGAGGTGGGAGG + Intergenic
1103386483 12:120536313-120536335 ACTTGGAAGGGTAAGGTGGGAGG + Intronic
1104059204 12:125253541-125253563 ACTAGGAAGGGTGAGGTGGGAGG - Intronic
1104109142 12:125689089-125689111 CCAGGGGAGGGGAGGGTTGGTGG + Intergenic
1104166700 12:126238496-126238518 ACTAGTAAGGGGAGGTTGGCTGG - Intergenic
1104347423 12:128013825-128013847 CCTAGCAAAGTGAGGGTGGGAGG + Intergenic
1104356826 12:128094327-128094349 CCCAGGAAGGGGAGGTTGCAGGG - Intergenic
1104437332 12:128766453-128766475 ACTAGAAAGGCCAGGGTGGGAGG + Intergenic
1104915219 12:132260883-132260905 CTTAGGAGGGGGATGGTGGAGGG + Intronic
1104917370 12:132272821-132272843 CCTGCGAAGTGGAGGGAGGGTGG - Intronic
1105204734 13:18211459-18211481 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1105416510 13:20217887-20217909 CTTAAGAAGGGGATGGTAGGTGG + Intergenic
1105578852 13:21675397-21675419 GCTGGGAAGGCGAGGGTAGGAGG - Intronic
1105932599 13:25067082-25067104 CTTAGCCAGGGTAGGGTGGGGGG - Intergenic
1106231970 13:27827392-27827414 CCTAGGAATGGGATAGTGGGTGG - Intergenic
1106402137 13:29441254-29441276 GCTAGGAAAGGCAGGGTGTGAGG + Intronic
1106462466 13:29983955-29983977 ACTAGAAACGGGAGGGAGGGAGG - Intergenic
1107412608 13:40172093-40172115 ACTAGGGGGTGGAGGGTGGGAGG - Intergenic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1107554077 13:41502310-41502332 CCAGGGAAGGGGAGGGGAGGAGG - Intergenic
1107605769 13:42054578-42054600 ACTAAGAAGGGGAGGGTGCTGGG + Intronic
1107830107 13:44367589-44367611 CTTGGGAAGAGGGGGGTGGGAGG - Intergenic
1107935949 13:45345464-45345486 CCTAGGCAGGCCAAGGTGGGAGG + Intergenic
1108683440 13:52799066-52799088 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
1108942282 13:55971640-55971662 CCTAGGGAGAGGAGGGTGGATGG + Intergenic
1109185728 13:59265343-59265365 GCTAAGAATGAGAGGGTGGGAGG + Intergenic
1109361468 13:61299523-61299545 TCTAGGAAGGCCAAGGTGGGTGG - Intergenic
1110222570 13:73089288-73089310 CTTTGGAAGGGCAAGGTGGGAGG - Intergenic
1110556533 13:76866023-76866045 GCTGGGAAGGGGAGGGTGGAGGG - Intergenic
1110798753 13:79670580-79670602 CCTGGGGATGGGAGTGTGGGTGG - Intergenic
1110916914 13:81031833-81031855 TATAGGAAGGGCATGGTGGGAGG - Intergenic
1111122825 13:83877679-83877701 GCTGGGGCGGGGAGGGTGGGTGG + Exonic
1111465221 13:88599489-88599511 TGTAGGAAGGTGAGGGTAGGAGG - Intergenic
1111677893 13:91409856-91409878 TCTAGAGAGGGGAGGGAGGGAGG - Intronic
1111927309 13:94477484-94477506 GCTAGAGAGGGGAGGGAGGGAGG + Intronic
1112187203 13:97138687-97138709 CCAAGAAAGGGGAGAGTGGTGGG + Intergenic
1112470027 13:99679719-99679741 AATGGGAAGGAGAGGGTGGGGGG + Intronic
1112512057 13:100018769-100018791 CAGAGGAAGGGCTGGGTGGGAGG + Intergenic
1113222322 13:108119436-108119458 CATAGGAAGTGGAGGTTGAGTGG - Intergenic
1113418967 13:110155136-110155158 CTTTGGAAGGGGATGGTTGGAGG + Intronic
1113553130 13:111208749-111208771 CCTGGGAAGTGTAGGGTGAGGGG + Intronic
1114531616 14:23400071-23400093 CCTGGGAAAGGAAGAGTGGGGGG + Intronic
1114652209 14:24292415-24292437 CCTGGGAAGGACAGGGTGGGTGG - Intronic
1114712335 14:24791272-24791294 CAGAGGATGGGGAGGGTAGGGGG + Intergenic
1115426826 14:33270158-33270180 ACTAGGAAGGAGAGGGTGGTAGG - Intronic
1116160580 14:41262798-41262820 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
1116596587 14:46856460-46856482 TCTAGCAAAGGGAGGGTGGCTGG - Intronic
1116931665 14:50696889-50696911 CCTTGAGAGTGGAGGGTGGGAGG - Intergenic
1117056559 14:51917785-51917807 CCTTGGAAGGCCAAGGTGGGCGG + Intronic
1117513377 14:56475083-56475105 CCAGGGAAGGGGAGGGTGAGAGG - Intergenic
1117694495 14:58345804-58345826 CCCAGGAAGTGGAGGCTGGAGGG - Intronic
1118171983 14:63396335-63396357 AGGAGGAAGAGGAGGGTGGGAGG + Intronic
1118433560 14:65747746-65747768 CTCAGAAAGAGGAGGGTGGGAGG + Intergenic
1118549197 14:66930767-66930789 CCTAGACAGGGCAAGGTGGGTGG - Intronic
1118719030 14:68580674-68580696 CCCAGGGAGGGGACAGTGGGAGG - Intronic
1119069941 14:71572420-71572442 CCTAAGAAGGGGTGCATGGGTGG - Intronic
1119182625 14:72614911-72614933 CCTGGGGAAGGGAGGGTGGGAGG - Intergenic
1119739961 14:77007929-77007951 TCTGGGAAGGAGAGGGTAGGAGG - Intergenic
1120666272 14:87310170-87310192 CCTAAGAAGGGGAGGCTTAGTGG - Intergenic
1120781967 14:88493531-88493553 CCCAGGACGGGGCGGGTGAGAGG + Intronic
1121255624 14:92528238-92528260 CCTAGGAGGGAGGCGGTGGGAGG - Intronic
1121279472 14:92688588-92688610 CCGAGGATGGGGTGGGTGTGGGG - Exonic
1121364764 14:93299094-93299116 CCTTGGAAGGGAAGGGAGGTGGG + Intronic
1122082289 14:99274301-99274323 CCCAGGAAGGTGAGGGTCGTGGG - Intergenic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122228998 14:100295778-100295800 CATGGGATGGGGAGTGTGGGTGG - Intronic
1122272368 14:100573932-100573954 ACTGGGAAAGGGTGGGTGGGAGG + Intronic
1122307109 14:100773228-100773250 GCCAGGGATGGGAGGGTGGGTGG - Intergenic
1122624653 14:103078195-103078217 CAGAGGAAGGGGAGGAAGGGAGG + Intergenic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122981762 14:105195280-105195302 CCTGGGAGCTGGAGGGTGGGGGG + Intergenic
1124044067 15:26131823-26131845 GAAAGGAAGGGGAGGGAGGGAGG - Intergenic
1124104977 15:26729348-26729370 CCAAGGAGGGGGAAGGTGGAGGG - Intronic
1124118768 15:26870331-26870353 CAGAGGAAGGGGTGGGTGTGGGG + Intronic
1124786053 15:32681691-32681713 CCTTGGAAGGCCAAGGTGGGAGG - Intronic
1124950978 15:34320481-34320503 GCTAGGAAGGGTAGGGGGGAAGG + Intronic
1125585367 15:40815807-40815829 ATTAGGGAGGGCAGGGTGGGGGG - Intronic
1125632609 15:41159681-41159703 CCTAGGGAGGCTAAGGTGGGAGG - Intergenic
1125660979 15:41394549-41394571 TCTTGGAAGGTGGGGGTGGGTGG - Intronic
1126233209 15:46352050-46352072 CGTAGAAGGGGGAGGGAGGGAGG - Intergenic
1126968056 15:54077970-54077992 CCAATGTAGGGGAGGCTGGGAGG - Intronic
1127289533 15:57557747-57557769 CCTAAGAATGGGGGTGTGGGGGG - Intergenic
1127637919 15:60888908-60888930 CCGAGGAGTGGGAGGGTGGGTGG + Intronic
1127675513 15:61234425-61234447 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
1127873046 15:63089219-63089241 CCTTGGAAGGCCAAGGTGGGAGG - Intergenic
1128029588 15:64468193-64468215 GAGAGGAAGGGGAGGGAGGGAGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128725617 15:69986532-69986554 CCTAGGAAAAGGAGGGTGGTGGG + Intergenic
1128949822 15:71866419-71866441 ACTAGGGAGGGTAAGGTGGGAGG + Intronic
1129186363 15:73909530-73909552 CCTGGGAAGTGGAGGGAAGGTGG + Intergenic
1129194028 15:73953679-73953701 TCTAGGAAGGAGAGGGGGTGGGG - Intergenic
1129356339 15:74994545-74994567 CCTAGGATGGTGTGGGTGGGGGG + Intronic
1129514120 15:76146445-76146467 CCTAGGCAGGGGAAGCTTGGAGG + Intronic
1129829028 15:78655322-78655344 GCTAGGATAGGGAGGCTGGGAGG - Intronic
1129905259 15:79182786-79182808 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
1129954836 15:79626812-79626834 GGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1130208686 15:81902446-81902468 GCTAGGAAGCAGAGGCTGGGAGG + Intergenic
1130266784 15:82412850-82412872 CCTTGGGAGGGCAAGGTGGGAGG - Intergenic
1130384114 15:83396356-83396378 CCAAAGAAGGGGGAGGTGGGAGG + Intergenic
1130878279 15:88032806-88032828 CCTGGGGAGGGGAGGGTGGTTGG - Intronic
1131390575 15:92044598-92044620 CCTAGGAGGAGGAAGGTGAGGGG - Intronic
1131475121 15:92731820-92731842 ACTAGAAGGGGGAGGGTGGAAGG + Intronic
1132110055 15:99096320-99096342 CCTGGGAATGGGAGGATAGGTGG + Intergenic
1132114362 15:99124892-99124914 CCTAGAAAGGGGAAGCTGTGGGG + Intronic
1132307066 15:100823828-100823850 CCCAGGAAGGGGAGGGGGCAAGG + Intergenic
1132350456 15:101136645-101136667 TCCTGGAAGCGGAGGGTGGGGGG - Intergenic
1132702566 16:1228397-1228419 CCTGGGCAGGGGAGGGCCGGAGG + Exonic
1132709192 16:1258922-1258944 CCTGGGCAGGGGAGGGCCGGAGG - Exonic
1132724048 16:1331198-1331220 CTCAGGGTGGGGAGGGTGGGCGG + Intergenic
1132822866 16:1885407-1885429 CAGAGGAAGGGGAGTGAGGGGGG + Intergenic
1132873566 16:2125988-2126010 GGTAGGAAGAGGATGGTGGGGGG + Intronic
1133034403 16:3026989-3027011 CCTGGGATGGGGAGGGGAGGAGG - Exonic
1133064091 16:3193671-3193693 CCTAGGAAGTGGAGGCTGCAGGG - Intergenic
1133233241 16:4376211-4376233 CCAAGGAAGGGGAGACGGGGCGG + Intronic
1133349967 16:5094781-5094803 CCTAGGATGGGCTGGGTGGGTGG + Intronic
1134006401 16:10821281-10821303 CCTGGGAAGGGGATATTGGGAGG + Intergenic
1134572560 16:15303846-15303868 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1134729822 16:16452176-16452198 CGGAGGAAGTGGGGGGTGGGGGG + Intergenic
1134937609 16:18259720-18259742 CGGAGGAAGTGGGGGGTGGGGGG - Intergenic
1135254800 16:20932633-20932655 CGTGGGGTGGGGAGGGTGGGGGG + Intergenic
1136087857 16:27898346-27898368 CCTCGCAGGGGGTGGGTGGGCGG - Intronic
1136401956 16:30024113-30024135 CCAAGGAAGGTGGTGGTGGGTGG - Intronic
1136478389 16:30526795-30526817 CCTGTGCGGGGGAGGGTGGGGGG - Intronic
1136911387 16:34147173-34147195 CCCAGCCAGGGGAGGGTGGCGGG - Intergenic
1136991820 16:35157199-35157221 ACTCAGAAGGGGAGGGTGGGAGG + Intergenic
1137442061 16:48506186-48506208 CTTTGGAAGGCCAGGGTGGGTGG + Intergenic
1137447369 16:48539975-48539997 ACTGGGAAGTGGAGAGTGGGAGG + Exonic
1137608453 16:49802652-49802674 CCTAGGCAGGGCAGGTGGGGTGG - Intronic
1137739123 16:50748437-50748459 CCTTGGAAGGCCAAGGTGGGAGG + Intronic
1137788453 16:51155036-51155058 CCTACGAAGGGCAACGTGGGGGG + Intergenic
1138200863 16:55087363-55087385 CCTGGGGTAGGGAGGGTGGGTGG + Intergenic
1138544512 16:57707682-57707704 CCTAGGGAGGGGGAGCTGGGTGG + Intronic
1138558700 16:57787528-57787550 CCCAGAAAGGGGAGGACGGGAGG + Intronic
1139027723 16:62839502-62839524 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1139633426 16:68244396-68244418 CCTTCGAAGGGGTGGGTGTGTGG + Intergenic
1140250320 16:73289320-73289342 CAGAGCAAGGGCAGGGTGGGGGG + Intergenic
1140562995 16:76005755-76005777 ACTCAGAAGGGGAGGGTAGGTGG + Intergenic
1140877146 16:79163185-79163207 CCTAGGAGGGAGAGATTGGGAGG + Intronic
1140998833 16:80288848-80288870 GCTAGGAATGGGTGGGTGGGAGG - Intergenic
1141103301 16:81213593-81213615 CCCAGGAAGGCCAAGGTGGGCGG + Intergenic
1141160680 16:81627543-81627565 CCTGGGAGGGCTAGGGTGGGTGG + Intronic
1141225008 16:82106555-82106577 CCTATGCAGGGCAGGGTGGAAGG + Intergenic
1141253238 16:82378073-82378095 CCTAGGAAAGGCAGAGGGGGTGG - Intergenic
1141411671 16:83838371-83838393 GGGAGGAAGGGGAGGGAGGGAGG + Intergenic
1141524796 16:84604307-84604329 CCGTGGGAGGGGAGCGTGGGTGG - Intronic
1141535304 16:84675273-84675295 CTTTGGAAGGCCAGGGTGGGAGG - Intergenic
1141690958 16:85595932-85595954 CGGAGGAATGGGTGGGTGGGTGG - Intergenic
1141777708 16:86135287-86135309 CCCAGGAAGAGCAGAGTGGGAGG - Intergenic
1141804871 16:86335948-86335970 CAGAGGCCGGGGAGGGTGGGTGG - Intergenic
1141909680 16:87050196-87050218 CTTAGGAAGGGGTCGGTGGACGG - Intergenic
1141984810 16:87572824-87572846 CCTGGGGAGGGGAGTGTGGGTGG - Intergenic
1142419932 16:89963945-89963967 CTTAGGGAGTGGAGGGCGGGGGG + Intronic
1142606377 17:1083649-1083671 CAGAGGGAGAGGAGGGTGGGAGG + Intronic
1142755532 17:2014393-2014415 CCTTGAATGGGGAGAGTGGGGGG - Intronic
1142939186 17:3367361-3367383 ACTTGGGAGGGAAGGGTGGGAGG - Intergenic
1143197818 17:5089650-5089672 CTTGGGCAGGGGTGGGTGGGAGG - Intronic
1143212153 17:5196389-5196411 CCAAGGGAGGGGAGGGAGAGGGG - Intergenic
1143258829 17:5583679-5583701 CCCAGGAAGGGGCAGGTGAGTGG - Exonic
1143713979 17:8753912-8753934 ACAAGGAAGGGGGGTGTGGGAGG - Intronic
1143772638 17:9178450-9178472 ATTAGGAAGAGGAGGGAGGGAGG - Intronic
1143811308 17:9473982-9474004 CCCAGGGAGGGGAGGGAGGCTGG + Intronic
1144090399 17:11851031-11851053 ACTAAGAAGGGGAGGTTGGTGGG + Intronic
1144382944 17:14720782-14720804 CCTAGTAATGGGATGGTGGAAGG - Intergenic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144757128 17:17686472-17686494 CCAGGGAAGGGGAGGCAGGGTGG + Intronic
1144758860 17:17695763-17695785 CTTAGGGAGGCGAAGGTGGGAGG - Intronic
1145005360 17:19334410-19334432 CCTTGGAAGGCGAGGGTCTGAGG - Exonic
1145277515 17:21442062-21442084 CCTTAGAAGGGGAGGGCTGGGGG + Intergenic
1145279015 17:21455044-21455066 AATAGGAAGGGGAGGGGGAGGGG - Intergenic
1145315352 17:21727957-21727979 CCTTAGAAGGGGAGGGCTGGGGG + Intergenic
1145748878 17:27341224-27341246 GCTGGGAAGAGGTGGGTGGGAGG - Intergenic
1145790744 17:27625117-27625139 CCTGGGAAGGGGCAGGTGTGTGG - Exonic
1146561140 17:33871598-33871620 ACTAGAATGGAGAGGGTGGGAGG - Intronic
1146591443 17:34131384-34131406 CCTAGGCAGTGGAGCTTGGGGGG - Intronic
1146693250 17:34891036-34891058 TGGAGCAAGGGGAGGGTGGGGGG - Intergenic
1147020345 17:37526759-37526781 CCTTAGAAGGGGAAGGTAGGAGG - Intronic
1147118733 17:38322401-38322423 CCCAGGAAGGGAAGGCCGGGTGG + Intronic
1147441958 17:40452893-40452915 CCCAGGAAGGAGAACGTGGGTGG + Intronic
1147694461 17:42340838-42340860 CCTAGGAAGGCAAGAGTGAGAGG - Intronic
1147725567 17:42564353-42564375 GGTAGGAAGGGGAGGATGGGGGG + Intronic
1147910504 17:43853324-43853346 ACCAGGAAGGGCAGGGTGGCAGG - Intronic
1147943915 17:44069562-44069584 CTTTGGAAGGCCAGGGTGGGTGG - Intergenic
1148026249 17:44589756-44589778 GCTAGGAGGGTGTGGGTGGGAGG - Intergenic
1148151621 17:45399921-45399943 CTTTGGAAGGGCAAGGTGGGAGG + Intronic
1148195285 17:45708657-45708679 CCTTGGAAGGAGAGGGGGAGTGG + Intergenic
1148329809 17:46806979-46807001 CCAAGGCAAGGGAGGGTGGGAGG + Intronic
1148339823 17:46866786-46866808 CCCAGGATGTGGTGGGTGGGTGG - Intronic
1148622626 17:49045773-49045795 CCTAGGATGGGGAGGGCCTGTGG + Intronic
1148746287 17:49920138-49920160 CCTAGGCAGGGGTGAGAGGGAGG - Intergenic
1148806103 17:50264725-50264747 CACAGGGAGGGGAGGGTGGAGGG + Intergenic
1148860955 17:50604133-50604155 CCTGGGGAGGGGAGGGAGGGAGG - Exonic
1149456907 17:56795262-56795284 CCTAGACAGGGCAGGATGGGAGG + Intronic
1149547946 17:57518318-57518340 CCTGGGGAGGGGAGGGGGAGAGG - Intronic
1149565509 17:57638181-57638203 CCTGGAGAGGAGAGGGTGGGGGG - Intronic
1149849853 17:60027850-60027872 CCTAAAAATGGGTGGGTGGGTGG - Intergenic
1149860315 17:60118674-60118696 CCTAAAAATGGGTGGGTGGGTGG + Intergenic
1149867377 17:60158180-60158202 CAAAGGAAGGGGTGGGTGTGCGG + Intronic
1149898026 17:60445866-60445888 CCTAGGAGGGGGTTGGTTGGGGG - Exonic
1149904762 17:60515357-60515379 CTTTGGAAGGCCAGGGTGGGTGG - Intronic
1150123766 17:62623484-62623506 CATGGGCAGGGTAGGGTGGGAGG + Intergenic
1150147683 17:62782877-62782899 CAGAGGAAGGGCAGGGTGAGAGG - Intronic
1150446735 17:65232163-65232185 CCAGGGATGGGGAGGCTGGGAGG + Intergenic
1150484420 17:65533801-65533823 CCTAGGTGGGGCAGGGTGGGAGG - Intronic
1150542027 17:66111703-66111725 ACTTGAGAGGGGAGGGTGGGAGG + Intronic
1150633851 17:66898929-66898951 CTTGGGAAAGGAAGGGTGGGAGG - Intergenic
1150855414 17:68747560-68747582 TGTAGGCATGGGAGGGTGGGTGG + Intergenic
1151251382 17:72838335-72838357 ACTTGGAAGGCTAGGGTGGGAGG - Intronic
1151361704 17:73593045-73593067 CCCAGGGAGGGTTGGGTGGGGGG + Intronic
1151565437 17:74894724-74894746 CCTAGGAAAGAGAAGTTGGGTGG + Intergenic
1152378010 17:79928654-79928676 CCTTGGGAGGTGAGGGTGGGAGG - Intergenic
1152507587 17:80760776-80760798 CATAGTAAAGGGAGGGAGGGAGG - Intronic
1152636556 17:81432757-81432779 CCTGGGGATGGGAGGGAGGGTGG - Intronic
1152744920 17:82034110-82034132 CCCTGGAGGGGGAGGGTGGGGGG + Exonic
1152928250 17:83097715-83097737 CCTGGGCAGGCCAGGGTGGGTGG + Intergenic
1153082526 18:1244826-1244848 CCTAGGAAAGTGAGTGTGGGAGG - Intergenic
1153290840 18:3499866-3499888 GGTGGGAAGGGGACGGTGGGCGG - Intronic
1153342930 18:3994091-3994113 CCTAGGAAAGGGAGGGTCACAGG - Intronic
1154197965 18:12279922-12279944 CCCATGCAGGTGAGGGTGGGTGG + Intergenic
1154344176 18:13528554-13528576 CTTTGGAAGGTGAAGGTGGGTGG - Intronic
1154349076 18:13568049-13568071 CCGAGGAGGTGGGGGGTGGGGGG + Intronic
1155200286 18:23511319-23511341 CTTGAGCAGGGGAGGGTGGGAGG + Intronic
1155292919 18:24359107-24359129 CCTGGGGAGGCTAGGGTGGGAGG + Intronic
1155380618 18:25218332-25218354 CGTGGTAAGGGGATGGTGGGAGG + Intronic
1156744503 18:40372486-40372508 CCCAGGAAAGGGAGAATGGGAGG - Intergenic
1157449975 18:47778770-47778792 CCTAGGGCTGGGAGGGTGGAGGG + Intergenic
1157513409 18:48294663-48294685 ACCAGGAAGGGAGGGGTGGGGGG - Intronic
1157719556 18:49913529-49913551 CCTCGGAAGATGAGAGTGGGTGG - Intronic
1159851984 18:73535367-73535389 CCTAGGCTGGGGAGGGCGGCTGG - Intergenic
1159973488 18:74681484-74681506 CCTTGGAAGGCCAAGGTGGGAGG - Intronic
1160391216 18:78534773-78534795 CCTGGGAAGGGCAGGGTGGGTGG + Intergenic
1160803457 19:980711-980733 CCCAGGGAGGGGAGGAGGGGAGG + Intergenic
1160826305 19:1082085-1082107 CCTGGGGAGGACAGGGTGGGCGG + Intronic
1160908744 19:1465101-1465123 GGTGGGCAGGGGAGGGTGGGGGG + Intronic
1160981058 19:1816856-1816878 GCAGGGAAGGGGAGGGAGGGAGG - Intronic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161709951 19:5842112-5842134 CATAGGGTGGGGAGGGTGTGGGG - Intergenic
1161756602 19:6138528-6138550 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1161801501 19:6418876-6418898 CCTGGGAAGGGGAGGAGCGGGGG + Exonic
1161926395 19:7303536-7303558 CAAAGGAAGGGGAGGGGGAGGGG + Intergenic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162019262 19:7861288-7861310 CCTATGAAGTGGAGGGAGGCGGG - Intronic
1162029326 19:7910610-7910632 CCTAGGAAGGGGCAGGGGTGAGG - Intronic
1162305473 19:9870656-9870678 CCTAAGAAGGGGAGAGTGCGGGG - Intronic
1162330747 19:10027747-10027769 CCCAGGGAGGGGAAGGCGGGCGG + Intergenic
1162956728 19:14102914-14102936 CCTGGGAAGGGAAGGAGGGGAGG + Exonic
1163263320 19:16204255-16204277 CCAAGGACAGGAAGGGTGGGGGG - Intronic
1163277406 19:16294031-16294053 CTTAGGAGGCTGAGGGTGGGAGG - Intergenic
1163431594 19:17271231-17271253 CTTAGGGAGGGCAAGGTGGGTGG - Intronic
1163469658 19:17488949-17488971 CCTGGGTAGGGAATGGTGGGTGG + Intronic
1163546127 19:17942448-17942470 CCTTGGACAGGGCGGGTGGGTGG - Intronic
1163551303 19:17967531-17967553 CCTGGGAGGGGGAGGGTGCAGGG + Intronic
1163621644 19:18364368-18364390 CTTTGGAAGGCCAGGGTGGGCGG + Exonic
1163715609 19:18870509-18870531 CCAAGGACGGGGAGCGTGGCCGG + Exonic
1163860085 19:19738199-19738221 CACAGGAAGGGGAGGGTCTGTGG + Intergenic
1164458253 19:28426898-28426920 CCTAAGGACAGGAGGGTGGGAGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1165311146 19:35030217-35030239 CCTGGGAAGGTGGGGGGGGGGGG + Intergenic
1165376948 19:35449605-35449627 CCTGGGAAGGGGACGGTGCCGGG + Intronic
1165761870 19:38326303-38326325 CCTTGGAAGGCAAAGGTGGGAGG + Intronic
1165763432 19:38335941-38335963 ACTAGGAAGGGGAGGGGAAGGGG + Intronic
1165773147 19:38389768-38389790 TCCGGGAAGGGGTGGGTGGGGGG + Intronic
1165805882 19:38580301-38580323 CCCAGCATGGGCAGGGTGGGGGG + Intronic
1165890916 19:39111813-39111835 CCAAGTGAGGGGCGGGTGGGAGG - Intergenic
1166167756 19:41004181-41004203 ACTGGGAGGGGGCGGGTGGGGGG + Intronic
1166254459 19:41592396-41592418 CCTGGGAAGGAGGGGGTGTGGGG - Intronic
1166310945 19:41962288-41962310 CCTAGGAGTGGGAGGGTGGGGGG + Intergenic
1166320542 19:42015876-42015898 GCTGGGAATGTGAGGGTGGGAGG - Intronic
1166350264 19:42194787-42194809 GACAGGAAGGGGAGGGAGGGAGG + Intronic
1166350506 19:42195761-42195783 GACAGGAAGGGGAGGGAGGGAGG - Intronic
1166409765 19:42548656-42548678 CCTGGGAATGGGGGGGGGGGGGG + Intronic
1166689271 19:44813018-44813040 CCTAGGAAGGAGAGAGCTGGGGG + Intronic
1166720496 19:44993258-44993280 TCTAGGAGGGGGAGTGTGGTAGG - Exonic
1166941444 19:46368710-46368732 CCTAGAAGGGGGAGAGTGGGAGG - Intronic
1166966024 19:46529649-46529671 AATAAGAAGGGGAGGGAGGGTGG + Intronic
1166973834 19:46591283-46591305 GCCAGGAAGGGTAGGGTGGAGGG - Intronic
1167144344 19:47672947-47672969 CCAAGGAAGGGGAGGGTGGTGGG - Intronic
1167342742 19:48925469-48925491 CCAGGGATGGGCAGGGTGGGGGG + Intergenic
1167489117 19:49781687-49781709 CCTAGGAAAGAGAGGGCAGGTGG + Intronic
1167618617 19:50549410-50549432 CCTGGGATGGGGAGAGGGGGAGG - Intronic
1167625425 19:50585303-50585325 CTTGGGAAGGCCAGGGTGGGAGG + Intergenic
1167631563 19:50629257-50629279 CCTGGGAAGGGGAAGGTCAGGGG + Intronic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1167889719 19:52529646-52529668 CCTAGGATTGGGAGGATGTGGGG + Intronic
1167898626 19:52601679-52601701 CCGTCGAAGGCGAGGGTGGGAGG - Intronic
1167903283 19:52637967-52637989 CCTACGAAGGCGAGGGTGGGAGG + Intronic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1167946497 19:52992941-52992963 CCGACGAGGGTGAGGGTGGGAGG + Intergenic
1168098384 19:54128283-54128305 CCTGGGGACGGGTGGGTGGGCGG - Exonic
1168189934 19:54730614-54730636 GCCAGGAAGGGAAGGGTGGAGGG - Intronic
1168202048 19:54822665-54822687 GCCAGGAAGGGAAGGGTGGAGGG - Intronic
1168206861 19:54856721-54856743 GCCAGGAAGGGAAGGGTGGAAGG - Intronic
1168336512 19:55600325-55600347 CGTGGGAAGGGGAGGGGGTGAGG - Intronic
1168433802 19:56302313-56302335 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
925818431 2:7776074-7776096 CTTAGGAAGATGAGGGTGGTCGG + Intergenic
926042946 2:9689626-9689648 CCTGAGAAGGGGAAGGTAGGGGG + Intergenic
926519442 2:13892147-13892169 GCTAGGAAGGGTAGGATGGAGGG - Intergenic
926906945 2:17814834-17814856 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
926945747 2:18185758-18185780 CCAAGGCAGGAGAGGGTGAGGGG + Intronic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
927469942 2:23366165-23366187 CTCAGAAGGGGGAGGGTGGGAGG + Intergenic
927541132 2:23912251-23912273 CTTAGGAAGGCCAAGGTGGGAGG + Intronic
927642646 2:24855192-24855214 CCTAAGAAGAAGGGGGTGGGGGG - Intronic
927711426 2:25328709-25328731 CCTAGAATGGGGATTGTGGGGGG - Intronic
927787165 2:25982048-25982070 CCTAGGGTGGGGACGCTGGGAGG + Exonic
927812115 2:26186010-26186032 GCTAGGAAGGGTGGGGTGGCTGG + Intronic
927884367 2:26709603-26709625 CGAGGGAAGGGGAGGGTGGTGGG + Intronic
928261754 2:29774281-29774303 TCTTGGCAGGGGAGGGTGGTTGG - Intronic
928628074 2:33161341-33161363 CCTGGGAGGTGGAGGTTGGGAGG - Intronic
928895324 2:36255655-36255677 GCTTGGAGGGGGAGGGAGGGAGG - Intergenic
929078441 2:38097720-38097742 GCTGGGAAGGAGAGGCTGGGTGG - Intronic
929109419 2:38393925-38393947 CCTGGGAGGCTGAGGGTGGGTGG + Intergenic
929592011 2:43153642-43153664 TCCAGGCAAGGGAGGGTGGGAGG + Intergenic
929892228 2:45927920-45927942 CGGAGGCAGGAGAGGGTGGGGGG + Intronic
929962295 2:46506009-46506031 CATAGTAAGGTGGGGGTGGGAGG + Intronic
929997266 2:46836478-46836500 CCCAGGAAGCGGAGTCTGGGAGG + Intronic
930090103 2:47525698-47525720 CCTAGGAAGAAGAGGCTGAGGGG + Intronic
930093228 2:47546915-47546937 GCTGAGAAGGGGAGGGAGGGAGG + Intronic
930626682 2:53706686-53706708 CCTTGGGAGGGCAAGGTGGGCGG - Intronic
930734134 2:54757802-54757824 CCTACCAGGGCGAGGGTGGGAGG - Intronic
930852513 2:55975622-55975644 GGTGGGAAGAGGAGGGTGGGGGG + Intergenic
931006699 2:57857954-57857976 ACTAGACAGGGGAGGGAGGGAGG - Intergenic
932023006 2:68106979-68107001 ACTAGGAAGGCTAGGATGGGAGG + Intronic
932166242 2:69510194-69510216 CCTTGAAGGTGGAGGGTGGGAGG - Intronic
932247679 2:70209207-70209229 CCTAGGAGGGGGAGGTTGCAGGG + Intronic
932341804 2:70967300-70967322 CCTAGGAAGGGAAAGAAGGGTGG + Intronic
932403173 2:71496122-71496144 CATATGAAGAGGAGGCTGGGAGG - Intronic
932703863 2:74008752-74008774 AGTAGGAAGGGAGGGGTGGGGGG + Intronic
933671701 2:85013837-85013859 CCTAGGCAGGGGTGGGGGAGGGG + Intronic
934553138 2:95274396-95274418 CATAGGAAGGGCAGGGGTGGAGG - Intergenic
934563706 2:95326860-95326882 CCGAGGAAGGGCAGGGCGAGGGG - Intronic
934654868 2:96112263-96112285 CCCAGGGAGGGGAGGGAGGAAGG - Intergenic
934949163 2:98564545-98564567 CAGAGGAAGGGGGCGGTGGGGGG + Intronic
934965933 2:98722522-98722544 CCTAGGAGGGGAGGGGAGGGAGG + Intronic
935265596 2:101391038-101391060 CCTCGGAAGGCCAAGGTGGGAGG - Intergenic
935325771 2:101935583-101935605 CCTAGCCAAGGGAGGGTGTGAGG + Intergenic
935443517 2:103131661-103131683 CCTAGGAGGTGGAGGCTGGAGGG + Intergenic
935707577 2:105870224-105870246 TCTCTGAAGGGGAGGGTAGGAGG - Intronic
936042732 2:109161930-109161952 CCTGGGGAGGGGAGGGTTGGGGG + Intronic
936063914 2:109316300-109316322 GCTGGGAAGGGGATGGAGGGAGG + Intronic
936465582 2:112745962-112745984 TCTAGGAAGGGGAAAATGGGAGG + Intronic
936525367 2:113237606-113237628 CCTGGGAAGGGGAGGCCAGGAGG - Intronic
937226747 2:120374724-120374746 CCTGGGAAGGGGAGGGGAGGAGG + Intergenic
937287073 2:120760423-120760445 CCCAGGAAGTGGAGGCAGGGTGG + Intronic
937381032 2:121376514-121376536 GCTGGGAAGGGGTGGGGGGGGGG + Intronic
937943719 2:127311633-127311655 CCTAGAGAGGGGAGGGGGAGTGG - Intronic
937988421 2:127649001-127649023 GGGAGGAAGGGGAGGGAGGGAGG + Intronic
938044619 2:128106791-128106813 CTTTGGAAGGGGCAGGTGGGTGG - Intronic
938826646 2:135012310-135012332 CCTAGGGTGGGAGGGGTGGGAGG + Intronic
938867227 2:135435137-135435159 ACTCGAAGGGGGAGGGTGGGAGG - Intronic
938890409 2:135698767-135698789 CCGAGGAAGAGAAGAGTGGGGGG + Intronic
939723941 2:145690804-145690826 ACTAAGATGGGGAGGGAGGGTGG + Intergenic
939883457 2:147656022-147656044 ACTAGGGATGGGAGGTTGGGGGG - Intergenic
940062196 2:149584803-149584825 CTTAGGGAGGCGAAGGTGGGTGG + Intronic
940179765 2:150918923-150918945 CTTAGGAAGGCCAAGGTGGGTGG + Intergenic
940660163 2:156535415-156535437 CCTAGGAAAGAGAGGGGGGTGGG + Intronic
940951741 2:159682914-159682936 CCTAGAAAGGTGTGTGTGGGGGG - Intergenic
942813793 2:180027655-180027677 GCTGGGAAGGGTAGGGAGGGGGG - Intergenic
943060387 2:183037636-183037658 CATAGGAAAGGGAGGGTGGTGGG - Intronic
943060844 2:183039862-183039884 CCTGAGAAGGGGAGGCTGCGAGG + Intergenic
943470783 2:188291950-188291972 ATTAGGAAGAGGAGGGAGGGGGG + Intronic
944412092 2:199456096-199456118 CCTAGGGAGGGGGTGGGGGGAGG + Exonic
944822435 2:203444054-203444076 AGAAGGAAGGGGAGGGAGGGAGG + Exonic
945246069 2:207718145-207718167 CCTTGGGAGGCCAGGGTGGGTGG - Intronic
945333502 2:208565621-208565643 CTTTGGGAGGCGAGGGTGGGTGG + Intronic
945445182 2:209928826-209928848 GCTAGGAAGGGGAGGCGGGAGGG - Intronic
946021923 2:216646226-216646248 CAGTGGAAGGGGAGGGTGGTGGG + Intronic
946127438 2:217575783-217575805 GCTAGGAAGGGGAGGGGGAAGGG + Intronic
946486286 2:220103621-220103643 TCTGGGAAGTGGAGGGTGAGAGG - Intergenic
946676757 2:222168590-222168612 CCTGGGAAGGGTAGTGAGGGAGG - Intergenic
946973613 2:225123125-225123147 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
947129666 2:226908414-226908436 CCTAGGAAGGGTAGGGAGGATGG + Intronic
947159064 2:227193792-227193814 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
947232674 2:227903647-227903669 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232682 2:227903664-227903686 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947232690 2:227903681-227903703 GGGAGGAAGGGGAGGGTGGGAGG - Intronic
947806121 2:232969436-232969458 GGAAGGAAGGGGAGGGAGGGAGG - Intronic
948453662 2:238093967-238093989 ACCAGGAGGGGGAGGGTGCGTGG + Intronic
948633842 2:239321220-239321242 CTTTGGAAGGTGAAGGTGGGCGG + Intronic
948644214 2:239393605-239393627 AGGAGGAAGGGGAGGCTGGGTGG - Intronic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948857653 2:240737544-240737566 ACAAGGAAAGGGAGGGAGGGAGG + Intronic
949027471 2:241773367-241773389 CCTGGGACGGGGAGGGCTGGGGG + Intergenic
1168997781 20:2145762-2145784 CCAAGGAAAGGCAGGGTGGCGGG - Exonic
1169189075 20:3645755-3645777 CCTGTGAAGGGGAGTGGGGGTGG - Intronic
1169305223 20:4483703-4483725 CTCAGGAAAGGGAGGGAGGGAGG - Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170799966 20:19582897-19582919 AGTCGGATGGGGAGGGTGGGAGG + Intronic
1170802851 20:19604477-19604499 GCTAGGCAGGGCTGGGTGGGGGG + Intronic
1171109119 20:22464315-22464337 CCCAGGAAGGGGAGGGAGGCTGG + Intergenic
1171208277 20:23297982-23298004 CCTAGGAAGGGGAGGCTCCCTGG + Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1171523796 20:25794599-25794621 CCTGGGAACCGGGGGGTGGGGGG + Intronic
1171553031 20:26061284-26061306 CCTGGGAACCGGGGGGTGGGGGG - Intergenic
1172034841 20:32003257-32003279 CCCAGGAGGGGGAGGGGGAGGGG + Exonic
1172113922 20:32562876-32562898 CCTAAGGAGGGCAGGGAGGGTGG + Intronic
1172196189 20:33093307-33093329 CAAATGAATGGGAGGGTGGGTGG - Intronic
1172292549 20:33786723-33786745 CTTTGGAAGGTGAAGGTGGGTGG + Intronic
1172578735 20:36030274-36030296 CTTAGGGAGGGGAGAGTGGCAGG + Intronic
1172714963 20:36956045-36956067 CCTTGGGAGGGCATGGTGGGTGG + Intergenic
1172761217 20:37323802-37323824 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic
1173059708 20:39650038-39650060 CCTAGGAAGAGAGAGGTGGGAGG - Intergenic
1173283082 20:41646559-41646581 TCTAGGAATGGGAGGGGGAGCGG - Intergenic
1173526737 20:43738525-43738547 CTTTGGAAGGGTAAGGTGGGTGG + Intergenic
1173727807 20:45309131-45309153 CCTGGGGAAGGCAGGGTGGGGGG - Intronic
1173750044 20:45469661-45469683 GCGGGGAAGGGGAGGGTGGAGGG - Intergenic
1173860861 20:46282749-46282771 CCGGGGGAGGGAAGGGTGGGTGG + Intronic
1174411020 20:50335739-50335761 CTTTGGAAGGCCAGGGTGGGTGG - Intergenic
1174761573 20:53211883-53211905 CCAAAGAGGGAGAGGGTGGGAGG - Intronic
1174842371 20:53912213-53912235 CCTCGGTTGGGGAGGGTGTGGGG + Intergenic
1174965614 20:55211182-55211204 CTTAAGAGGGGGAGGGTGGAAGG + Intergenic
1175074040 20:56358936-56358958 CGGAGGCCGGGGAGGGTGGGCGG - Exonic
1175570236 20:60012585-60012607 GCGAGGAAGGGGAGTGTGGAGGG + Exonic
1175573874 20:60045730-60045752 CAGAGGCAGGGGAGGGTAGGAGG + Intergenic
1175828862 20:61951178-61951200 CCCAGGAAAAGGAAGGTGGGGGG - Intergenic
1175889015 20:62307880-62307902 CCTTGGAAGGTGAGCGTGCGAGG - Intronic
1176027529 20:62993557-62993579 GGGAGGCAGGGGAGGGTGGGAGG + Intergenic
1176126582 20:63478221-63478243 CATAGGAGGGGGCGTGTGGGAGG - Intergenic
1176143886 20:63557014-63557036 GCTGGGCAGGGGATGGTGGGAGG - Intergenic
1176164110 20:63663933-63663955 CCTTGGAGGGACAGGGTGGGCGG + Intronic
1176172150 20:63700937-63700959 CCCAGGGAGGGGATGGGGGGTGG - Intronic
1176550793 21:8220222-8220244 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176550908 21:8220954-8220976 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176569591 21:8402489-8402511 CCAAGGAAGGGGAGGGAGGGAGG - Intergenic
1176569707 21:8403221-8403243 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176569817 21:8403953-8403975 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176577618 21:8447428-8447450 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176577728 21:8448160-8448182 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1176682381 21:9826101-9826123 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176682660 21:9827510-9827532 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176683219 21:9830326-9830348 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176683498 21:9831736-9831758 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176684055 21:9834546-9834568 CCTGGGACCCGGAGGGTGGGGGG + Intergenic
1176684618 21:9837354-9837376 CCTGGGAACCGGGGGGTGGGGGG + Intergenic
1176713245 21:10326628-10326650 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1177571159 21:22888872-22888894 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1177662596 21:24105497-24105519 GCTAGGAGGGGGAGGGAGGAAGG + Intergenic
1177908513 21:27000832-27000854 ACTTGAAAGGGGATGGTGGGAGG + Intergenic
1178404211 21:32311409-32311431 TTTAGGATGGGGGGGGTGGGGGG - Exonic
1178638117 21:34322902-34322924 TCTCTGAAGGGGAAGGTGGGAGG - Intergenic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1180164514 21:46017031-46017053 TCTAGCAAAGGGAGGGAGGGAGG + Intergenic
1180180268 21:46115826-46115848 TCGAGGCAGGGTAGGGTGGGCGG - Intronic
1180185155 21:46135740-46135762 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185166 21:46135767-46135789 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185183 21:46135807-46135829 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180185194 21:46135834-46135856 GCTGGGGAGGGGAGGCTGGGAGG - Intergenic
1180228895 21:46414559-46414581 TCCAGGAGGAGGAGGGTGGGCGG - Intronic
1180698323 22:17768424-17768446 CCTGGGCAGGGGAGGGAGGCAGG - Intronic
1180829628 22:18897210-18897232 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
1181335379 22:22124760-22124782 CCCAGGGCGGGGCGGGTGGGGGG + Intergenic
1181477994 22:23180484-23180506 CGCAGGAAGGGGAGGGCCGGGGG - Exonic
1181510129 22:23385348-23385370 CCACAGCAGGGGAGGGTGGGAGG - Intergenic
1181625931 22:24122056-24122078 GCAGGGAAGTGGAGGGTGGGTGG - Intronic
1181642486 22:24210626-24210648 CTTTGGAAGGCCAGGGTGGGCGG + Intergenic
1181719623 22:24763813-24763835 CCGAGGCAGGAGATGGTGGGCGG - Intronic
1182310972 22:29406217-29406239 CCCGGGCAGGGGAGGGTGGAAGG - Intronic
1182435248 22:30326142-30326164 CCTGGGAAGGGGTGGGGGCGGGG + Intronic
1182690138 22:32154885-32154907 CCCGGGCAGGGGAGGGTGGAAGG + Intronic
1182727833 22:32461928-32461950 CCTTGGAAGGCCAAGGTGGGCGG + Intronic
1183107140 22:35622721-35622743 CCAAGGCTGGGGAGGGTGGAGGG - Intronic
1183107171 22:35622831-35622853 TGAAGGAAGGGGAGGATGGGTGG - Intronic
1183381571 22:37492881-37492903 CTTAGGAAGGGATGGGTGGCGGG - Intronic
1183675691 22:39297686-39297708 CCCAGGAAGGGGAGGGGGCAGGG - Intergenic
1183745058 22:39687244-39687266 CCCAGGAGGGCGGGGGTGGGTGG + Exonic
1183811241 22:40259586-40259608 CCCAGTAAGGGGAGGGGGAGTGG - Intronic
1184214497 22:43057749-43057771 AGTGGGCAGGGGAGGGTGGGAGG + Intronic
1184292594 22:43506026-43506048 CCTGGGTTGGGGTGGGTGGGAGG + Exonic
1184477370 22:44728936-44728958 CCTAGGAAGGGGAGGAAGACTGG + Intronic
1184523399 22:45008498-45008520 CCTGGGATGGGGCGGGAGGGTGG - Intronic
1185167095 22:49268177-49268199 GCCAGGCAGGGGTGGGTGGGCGG - Intergenic
1185328541 22:50240126-50240148 CCTTGGATGGGGTGTGTGGGGGG - Intronic
1203255694 22_KI270733v1_random:136546-136568 CCAAGGAAGGGGGGGGAGGGAGG - Intergenic
1203255808 22_KI270733v1_random:137231-137253 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1203255917 22_KI270733v1_random:137921-137943 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1203279719 22_KI270734v1_random:122482-122504 GCTAGGAGGGGGAGGGAGGAAGG - Intergenic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
949414104 3:3798704-3798726 CCGAGGAAGGGGAGGAGGGTGGG - Intronic
949452440 3:4201283-4201305 GCTAGGAAGGGTAGTGTGTGGGG - Intronic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
949862627 3:8520480-8520502 TTTAGGAAAGGCAGGGTGGGAGG + Intronic
949970038 3:9396886-9396908 CGAAGGAAGGGGAGGGTGGGAGG + Intergenic
949988096 3:9554861-9554883 ACTAGGGAGGGTAAGGTGGGGGG + Intergenic
950497931 3:13345405-13345427 CCTGGGAAGTGGAGAGTCGGAGG - Intronic
950514383 3:13454648-13454670 AGGAGGAAGGGGAGGTTGGGGGG + Intergenic
950615219 3:14152657-14152679 CCTATGAAGGGGAGGAGTGGTGG - Intronic
950676132 3:14555373-14555395 CCTGGGAAGGGGTGGGGGCGGGG + Intergenic
950707447 3:14791814-14791836 CCTGGGAAGGGGTGGGCTGGAGG + Intergenic
951194137 3:19804704-19804726 CCTAGGAAGGGGGAAGGGGGAGG + Intergenic
951758964 3:26124192-26124214 ACTAGAAGGGGGAGGGTGGGAGG + Intergenic
952195908 3:31075152-31075174 CCTAGTAAAGAGATGGTGGGGGG + Intergenic
952232668 3:31447998-31448020 CCTAGGTAGGGGTGTGGGGGAGG + Intergenic
952342172 3:32455787-32455809 CCTAGGAGGGCAAAGGTGGGTGG + Intronic
952588971 3:34928304-34928326 CATAGAAGTGGGAGGGTGGGAGG + Intergenic
952687350 3:36164901-36164923 CTTTGGAAGGTGAAGGTGGGTGG + Intergenic
952758304 3:36891447-36891469 CCCAGGAATGGGGGTGTGGGAGG - Intronic
953081241 3:39620537-39620559 CCCAGAAATGGGAGGGTGAGAGG + Intergenic
953754287 3:45633194-45633216 CCTGTGGAGGGGAGGGTGGCGGG - Intronic
953810337 3:46107435-46107457 TCTGGGCTGGGGAGGGTGGGAGG + Intergenic
954014118 3:47670939-47670961 CCTTGGGAGGGCAAGGTGGGTGG + Intronic
954124155 3:48518870-48518892 CCAGGGAAGGGGAGAGGGGGCGG + Exonic
954304906 3:49720489-49720511 CCTAGGTAGGGGAGGGTGCAAGG - Exonic
954380067 3:50214617-50214639 AATGGGACGGGGAGGGTGGGAGG - Intronic
954446060 3:50547498-50547520 GCTCGGTAGGGGTGGGTGGGAGG + Intergenic
954822830 3:53346861-53346883 TCTTGGAAGGAGGGGGTGGGTGG - Intronic
954980026 3:54737512-54737534 CCTGGGAAGAAGAGGGTGGTTGG + Intronic
955032545 3:55234804-55234826 CTCAGGAGGGGGATGGTGGGAGG - Intergenic
955442684 3:58974254-58974276 ACTAGTAGGGGGAAGGTGGGAGG - Intronic
955649097 3:61174043-61174065 CATATTAAGGGGAGTGTGGGAGG + Intronic
955985557 3:64570572-64570594 CTTAGGTAGGGGAAGTTGGGAGG + Intronic
956392527 3:68788865-68788887 CCTTGGAAGGCCAGGGTAGGAGG - Intronic
956640820 3:71414011-71414033 CCTAGGAAGGGATGGATGGATGG - Intronic
956761152 3:72446761-72446783 CCCCGGAAAGGGTGGGTGGGTGG - Exonic
956903054 3:73736657-73736679 CCTGGGAAAGGGAGGGAAGGAGG + Intergenic
956933237 3:74070345-74070367 ACTTGGGAGTGGAGGGTGGGAGG + Intergenic
957054267 3:75432137-75432159 CCTAGGATGGGCTGGGTGGGTGG + Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957662376 3:83177431-83177453 ACTAGGAAGGCTAAGGTGGGAGG - Intergenic
957751140 3:84417495-84417517 GCTAGGAAGAGTAGGGTGGAGGG + Intergenic
957826111 3:85446843-85446865 CATAGGGAGGCCAGGGTGGGAGG - Intronic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
958986473 3:100784875-100784897 CCCAGAAGGGGGAGGGTGAGAGG + Intronic
959115210 3:102169401-102169423 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
959128242 3:102317612-102317634 GCTTGAAAGTGGAGGGTGGGAGG - Intronic
959416240 3:106078994-106079016 GGAAGGAAGGGGAGGGAGGGAGG - Intergenic
959603552 3:108216915-108216937 CATAGGATGGGAAGGGTAGGGGG + Intronic
959937177 3:112041271-112041293 CCTAGGAAGTGTAGGGAGGCTGG - Intronic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960435200 3:117618212-117618234 ATTAGAGAGGGGAGGGTGGGAGG + Intergenic
960495924 3:118374842-118374864 CCAAGGAAGTGGTTGGTGGGAGG + Intergenic
960907975 3:122620721-122620743 GCCTGGGAGGGGAGGGTGGGAGG + Intronic
961021300 3:123509475-123509497 CACAGGAAGGGGAAGGTTGGAGG - Intronic
961109778 3:124274131-124274153 CCCAGGAAGGGGTGTGTCGGGGG - Intronic
961300573 3:125919575-125919597 CCTAGGATGGGCTGGTTGGGTGG - Intergenic
961495524 3:127288421-127288443 GCTGGGAAGGGCAGGGAGGGAGG + Intergenic
961887928 3:130108512-130108534 CCTAGGATGGGCTGGGTGGGTGG + Intronic
961940911 3:130636847-130636869 GGAAGGAAGGGGAGGGGGGGAGG - Intronic
961945556 3:130683164-130683186 CATAGGAAGAGCAGGGTAGGAGG + Intronic
962002488 3:131312971-131312993 ACTAGAAGGTGGAGGGTGGGAGG - Intronic
962089701 3:132230374-132230396 ACTGGGGAGGAGAGGGTGGGAGG - Intronic
962153621 3:132919885-132919907 ACTCGGAAGGGGAGGGTGGGAGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963253230 3:143120581-143120603 CTTAGGAGGAGGAGGCTGGGAGG + Intronic
963605637 3:147410054-147410076 CCTCGGCTGGCGAGGGTGGGGGG + Exonic
963884097 3:150561332-150561354 CTTTGGAAGGCCAGGGTGGGTGG + Intronic
963897587 3:150703467-150703489 TCGAGGAAGGGGTGGGTCGGGGG + Intronic
964093793 3:152907822-152907844 CCTAGACAGGGGAGGGAAGGAGG + Intergenic
964205331 3:154168331-154168353 CTTTGGAAGGTGGGGGTGGGTGG + Intronic
965036720 3:163449342-163449364 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
965531257 3:169773000-169773022 CCGAGGAAGGGGAGGATGATGGG + Exonic
965757388 3:172040186-172040208 CCCAGGAGGGGGAGGGCGGGCGG + Intronic
966168625 3:177051290-177051312 CCTGGGGGGTGGAGGGTGGGAGG + Intronic
966925865 3:184644240-184644262 CTTTGGAAGGTCAGGGTGGGTGG - Intronic
967148549 3:186627179-186627201 TCAGGGAAGGTGAGGGTGGGAGG - Intergenic
967277844 3:187794186-187794208 CATTGGAAGGGGAGAGTGAGTGG + Intergenic
967817941 3:193815000-193815022 CTTAGGACGTGGAGGGTGGTTGG - Intergenic
967871537 3:194233990-194234012 GCGAGGAAGAGGAGGTTGGGGGG - Intergenic
967948062 3:194819643-194819665 CCCAGGAAGGGGTGGGAGGATGG + Intergenic
968135806 3:196218583-196218605 CCACTGAAGGGGAGGGTGTGGGG + Intronic
968211645 3:196854014-196854036 CTTTGGAAGGTGGGGGTGGGCGG - Intergenic
968317377 3:197736441-197736463 CTTAGGGTGAGGAGGGTGGGTGG - Intronic
968438074 4:605645-605667 CCAAGGAAAGGGAGAGAGGGAGG - Intergenic
968743039 4:2340859-2340881 CCTAGAAAGGGGAGGCGGGCAGG + Intronic
969239450 4:5889118-5889140 GCTAGGATGGAGAGGGTGGCAGG - Intronic
969306148 4:6327335-6327357 CGCAGGAAGTGGCGGGTGGGAGG + Intronic
969326487 4:6447338-6447360 CATGGAAACGGGAGGGTGGGAGG - Intronic
969448697 4:7260375-7260397 CCTGGGAGGGGGGAGGTGGGAGG - Intronic
969467434 4:7366136-7366158 CCAAGGAGGAGGAGGGTGGCAGG - Intronic
969517189 4:7654366-7654388 CCTGGGATGAGGAGGGTGTGGGG - Intronic
969584736 4:8085190-8085212 CCTGGGGAGGGGAGAGTGGCTGG - Intronic
969816903 4:9693810-9693832 CCTAGGATGGGCTGGGTGGGTGG - Intergenic
969902672 4:10364237-10364259 CCTAGTATGGGGGGGGGGGGGGG - Intergenic
969951987 4:10846533-10846555 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
970508771 4:16759388-16759410 TCTAGGAAAGGGTAGGTGGGCGG + Intronic
971177151 4:24292674-24292696 CGTAGGAAGGGGTGGGGGTGAGG - Intergenic
972151680 4:36099042-36099064 CATGGGGAGGGGAGGGTAGGGGG - Intronic
972533147 4:39977928-39977950 CGGAGGAAGGGGAGGGAGCGAGG - Exonic
972647675 4:40984475-40984497 CCAAAGAAAGGAAGGGTGGGGGG + Intronic
972701617 4:41499574-41499596 CTTTGGAAGGGCAAGGTGGGGGG + Intronic
973330463 4:48906530-48906552 CCGAGTTAGGGGAGAGTGGGGGG + Intronic
975558169 4:75684652-75684674 CCTAGGGAGGCTAAGGTGGGAGG - Intronic
975650508 4:76588475-76588497 TCTAGGAGGGGGAGGCTGCGTGG - Intronic
975699742 4:77052113-77052135 ACTAGAAGGGGGAGGGAGGGAGG - Intronic
975778707 4:77818712-77818734 CCTGGGCAGGTGAGGGTCGGAGG - Intronic
976717178 4:88135505-88135527 TGTAGGGATGGGAGGGTGGGAGG - Intronic
977092457 4:92695073-92695095 ACTAGGAAGGCTAAGGTGGGAGG - Intronic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
978008045 4:103642651-103642673 GCTGGGAAGGGTAGGGTGGAGGG + Intronic
978708804 4:111751704-111751726 AGTATGAAAGGGAGGGTGGGAGG + Intergenic
978806486 4:112806203-112806225 GCTAGGAAGGGTAGTGTGAGGGG - Intergenic
979677230 4:123423262-123423284 GGTGGGAAGGGGAGGGTGGGTGG + Intergenic
979988902 4:127350706-127350728 ACTTGCGAGGGGAGGGTGGGAGG + Intergenic
980147950 4:129013136-129013158 ACTTGAAAGGAGAGGGTGGGAGG - Intronic
980203454 4:129685942-129685964 ACTAGGAAGGCTAAGGTGGGAGG + Intergenic
980455007 4:133028032-133028054 ACTGGAGAGGGGAGGGTGGGAGG + Intergenic
980963803 4:139501426-139501448 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
981046578 4:140270440-140270462 ACTAGGGAGGGTAAGGTGGGAGG - Intronic
981175929 4:141683325-141683347 CTTTGGAAGGGCAAGGTGGGTGG + Intronic
982199205 4:152943488-152943510 CCTAGGAAGGGAAGACTTGGTGG - Exonic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
982629533 4:157814393-157814415 ACTAGAGAGGGGAGGGAGGGAGG + Intergenic
983018658 4:162647126-162647148 CCAAAAAAGGGGAGGGTGGGAGG - Intergenic
983174745 4:164575219-164575241 ACTAGAGAGGGGAGGGTGGAAGG + Intergenic
983513061 4:168629625-168629647 CCCAGGAAGGGATGGGAGGGTGG - Intronic
983548207 4:168985902-168985924 ACTTGAAAGTGGAGGGTGGGAGG + Intronic
983586597 4:169362310-169362332 GCTGGGAAGGGGAGTGGGGGTGG + Intergenic
983798272 4:171893951-171893973 GCTAGAGAGGGGTGGGTGGGTGG - Intronic
983843989 4:172493868-172493890 GCTTGGAAGGGGAGGGTATGAGG - Intronic
984769600 4:183425938-183425960 CACAGGAGGGGGAGGGGGGGAGG - Intergenic
984952299 4:185016788-185016810 CCTTGGCAGGGGTGGGTAGGCGG - Intergenic
985929619 5:3046967-3046989 ATTAGGAAGAGAAGGGTGGGTGG + Intergenic
986065375 5:4229585-4229607 CAGAGGAAGGGCAGGGTTGGCGG - Intergenic
986211995 5:5682660-5682682 ACTAGGAAGGGGAAGGTGAAGGG + Intergenic
986530121 5:8727047-8727069 GCGAGGAAGGGAAGGGAGGGAGG + Intergenic
986687501 5:10287481-10287503 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
987015227 5:13811076-13811098 GCTAGGAAGGGGAGTGGGGAGGG + Intronic
987320930 5:16768782-16768804 GCTTGGGAGGAGAGGGTGGGAGG - Intronic
988080824 5:26412231-26412253 GCTAGGAAGGAGAAGGTGGGAGG - Intergenic
988297932 5:29390527-29390549 TTCAGGAAGGGGAGGGTGGCCGG - Intergenic
988469843 5:31527640-31527662 CCTGGTAAGGGGTGGGTGGCAGG - Intronic
989460254 5:41689500-41689522 CCAAAAAATGGGAGGGTGGGAGG - Intergenic
989593599 5:43135072-43135094 CCTGGGAGGCGGAGGTTGGGGGG - Intronic
989607536 5:43258921-43258943 CTTAGAAGGGGTAGGGTGGGAGG - Intronic
991008782 5:61859785-61859807 CTTTGGAAGGTCAGGGTGGGCGG - Intergenic
991367808 5:65887179-65887201 CCTTAGAAGGGGAAGGTTGGTGG + Intergenic
992171031 5:74102269-74102291 TGAAGGAAGGGGAGGGGGGGAGG - Intergenic
992216199 5:74527063-74527085 TCTAGAAAGGGGAGGCAGGGAGG + Intergenic
992403612 5:76434340-76434362 CTCAGAAAGAGGAGGGTGGGAGG - Intronic
992534843 5:77689421-77689443 CTTGGGAAGGGGTGGGTGGGTGG - Intergenic
992785150 5:80163096-80163118 CTTTGGGAGGGCAGGGTGGGTGG - Intronic
992856662 5:80868612-80868634 ACTAGATGGGGGAGGGTGGGAGG + Intronic
993803727 5:92377143-92377165 ACTTGGAAGGGTAAGGTGGGAGG + Intergenic
994535970 5:101029796-101029818 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
994676911 5:102834755-102834777 ACCAGGAAGGGAAGGGTGGAGGG + Intronic
994820525 5:104645082-104645104 CATAGGAATCTGAGGGTGGGAGG - Intergenic
995214910 5:109584002-109584024 CATAGGAAGGGGTGGGTGAAAGG + Intergenic
995269975 5:110208897-110208919 CCTTGAAGGGGGAGGATGGGAGG - Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996991512 5:129637961-129637983 ACTTGAATGGGGAGGGTGGGAGG + Intronic
997194405 5:131968303-131968325 CCTGGGTAGGGTAGGATGGGGGG + Intronic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997401912 5:133610649-133610671 CCTGGGAAGGGAATGGTCGGAGG - Intronic
997412952 5:133704046-133704068 CCTAGGGGTGGGAGGGTGGAGGG + Intergenic
997530765 5:134579941-134579963 GCAAGGGAGGGGAGGGTGGCAGG - Exonic
998098019 5:139408399-139408421 ACTAGGAAGGTTAAGGTGGGAGG - Intergenic
998128172 5:139637988-139638010 CTCAGGAGGGTGAGGGTGGGGGG - Intergenic
998201394 5:140125912-140125934 CATGGGGTGGGGAGGGTGGGTGG + Intergenic
998851197 5:146352405-146352427 CGTAGGGAGGGCAAGGTGGGAGG - Intergenic
998887112 5:146706169-146706191 CGTAGGAGGGGCAGGCTGGGAGG + Intronic
998943647 5:147313157-147313179 CCTTGGAAGTGGAGGCTGCGGGG + Intronic
999304442 5:150510516-150510538 CCTTGGGACGGGAGGGTGGCAGG + Intronic
999394810 5:151220790-151220812 GGTAGGAAGCGGAGGGGGGGTGG - Intronic
999769016 5:154761144-154761166 CCTTTGAAGGGGAGAGTGGGAGG + Intronic
1000352079 5:160359948-160359970 CCTAGAAAAGGTAGGGGGGGTGG - Intronic
1000642553 5:163719811-163719833 ACTTGGAGGTGGAGGGTGGGAGG + Intergenic
1000698186 5:164415600-164415622 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1000995082 5:167950448-167950470 TCTGGAGAGGGGAGGGTGGGGGG + Intronic
1001106236 5:168856967-168856989 CCTGGGGAAGGGATGGTGGGGGG + Intronic
1001242368 5:170080441-170080463 CCCAGGAAGTGGTGGGTGTGGGG - Intronic
1001493148 5:172169496-172169518 CAGAAGAATGGGAGGGTGGGTGG + Intronic
1001596651 5:172902971-172902993 CCTGGGGAGGTGTGGGTGGGGGG - Intronic
1002444405 5:179280283-179280305 ACTTTGAAGGGCAGGGTGGGGGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1003114926 6:3277357-3277379 CCTGGAAGGGTGAGGGTGGGCGG - Intronic
1003232809 6:4270077-4270099 CCTAGGAGCTGGTGGGTGGGCGG - Intergenic
1003468643 6:6407225-6407247 CTTAGAAAGTGGAGGATGGGAGG - Intergenic
1003491732 6:6628251-6628273 AGGAGGAAGGGGAGGGAGGGAGG - Intronic
1003837559 6:10088029-10088051 CTCAGGAAGGGGTGGGTGGGAGG - Intronic
1004131168 6:12921511-12921533 GGAAGGAAGGGGAGGGAGGGAGG + Intronic
1004170674 6:13293330-13293352 CTCAGAAGGGGGAGGGTGGGAGG + Intronic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1005030837 6:21507478-21507500 CTTAGGAATGGGAGGCTGAGGGG + Intergenic
1005393854 6:25361393-25361415 GCTTGGAAGGGTGGGGTGGGAGG - Intronic
1005498410 6:26409153-26409175 GTTAAGAAAGGGAGGGTGGGAGG + Intronic
1005723759 6:28628884-28628906 CCTAAGAGCTGGAGGGTGGGTGG + Intergenic
1005843382 6:29759183-29759205 CATAGCAAGGGGAGGATGGTGGG + Intergenic
1005981777 6:30842056-30842078 CCCAGGCAGGAGAGGATGGGAGG + Intergenic
1005989024 6:30891964-30891986 CCAAGGAAGAGGAGGTTGGAAGG - Intronic
1006162835 6:32048101-32048123 CCCAGGAACGGGAGGGTGACTGG + Intronic
1006338103 6:33431552-33431574 CCAAGGAAGGGGCAGGTGGGGGG - Intronic
1006514136 6:34536696-34536718 CCTTGTAGGAGGAGGGTGGGGGG - Intergenic
1006578956 6:35065626-35065648 CCTGGGAAGGGAAGATTGGGAGG - Intronic
1006605592 6:35254615-35254637 CCCAGGAAGGGGAGGTTGCAGGG + Intergenic
1007085699 6:39143278-39143300 CCTAGGAAGGGCAGGGGAGCTGG - Intergenic
1007088419 6:39166903-39166925 CCGAGGAAGGGGAGAGAAGGAGG - Intergenic
1007284969 6:40741070-40741092 CCCAGCAAGATGAGGGTGGGTGG + Intergenic
1007388199 6:41533695-41533717 CCAAGGTCAGGGAGGGTGGGTGG - Intergenic
1007664731 6:43507505-43507527 CCCAGGAATGGGAGAGAGGGCGG - Exonic
1007879510 6:45147658-45147680 CATAGGAAGAGGTGGCTGGGAGG + Intronic
1008608702 6:53166211-53166233 CCAAAAGAGGGGAGGGTGGGAGG + Intergenic
1008876317 6:56333292-56333314 CCTAGGAAGGGGAGGGTGGGAGG - Intronic
1010146843 6:72680191-72680213 CCTAGGAAAGGGGTGGTGGTAGG - Intronic
1010151011 6:72732310-72732332 ATTAGGAAGGGGAGGGGAGGTGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010414559 6:75599166-75599188 CCTTGGAAGGTCAAGGTGGGTGG + Intergenic
1011362618 6:86544062-86544084 ACTAGAGAGGGGAGGGAGGGAGG + Intergenic
1011697901 6:89929617-89929639 GCAAGGCAGGGGTGGGTGGGAGG + Exonic
1011862492 6:91777128-91777150 ACTAGAGAGGGGAGGGTGGGAGG + Intergenic
1012239504 6:96856179-96856201 ACTTGGGAGGGAAGGGTGGGAGG - Intergenic
1012333087 6:98018067-98018089 GGTAGCAAGGGGAGGGAGGGAGG + Intergenic
1012673362 6:102085280-102085302 CATAGGAAGAGGAGATTGGGTGG - Intergenic
1013007027 6:106083241-106083263 AGTAGGAAGAAGAGGGTGGGGGG + Intergenic
1013239404 6:108229430-108229452 GGAAGGAAGGGGAGGGAGGGAGG - Intronic
1014157637 6:118129558-118129580 TCTAGAAAGGGGATGGTGGCTGG + Intronic
1014307412 6:119759081-119759103 CCAAGGAGGGAGAGGGAGGGAGG - Intergenic
1014471246 6:121817294-121817316 AATAGGCAGGGGAGGGTGAGAGG + Intergenic
1014726744 6:124980368-124980390 TCTGGGAAGGGGAGGGTGGTAGG - Intronic
1014755535 6:125298571-125298593 CTTAGGAAGGGGAAGGTCAGGGG - Intronic
1015289658 6:131524316-131524338 CCTAGGAAGATGATGGTTGGAGG - Intergenic
1015578107 6:134694191-134694213 GCTAGGAAGGGTAGTGTGGCAGG - Intergenic
1015579554 6:134708744-134708766 ACTAGGCAATGGAGGGTGGGTGG - Intergenic
1015725529 6:136295738-136295760 TTTAGGAAGGTGAGGGTGGGAGG - Intergenic
1015790092 6:136957702-136957724 CCTGGGACTGGGTGGGTGGGTGG - Intergenic
1015981481 6:138843931-138843953 CCTTGGGAGGCCAGGGTGGGCGG - Intronic
1016385972 6:143531250-143531272 CTCAGAAAGGGGAGGGTGAGAGG + Intergenic
1017004593 6:150020722-150020744 AGAAGGAAGAGGAGGGTGGGAGG + Intronic
1017138874 6:151172278-151172300 CGAAGGAGGGGGAGGGAGGGAGG - Intergenic
1017147743 6:151249999-151250021 CTTCGGGAGGTGAGGGTGGGAGG + Intronic
1017842290 6:158232036-158232058 CCTGGGCCGGGGAGGGAGGGCGG + Intergenic
1017884331 6:158586702-158586724 CTTTGGGAGGGTAGGGTGGGAGG + Intronic
1018315564 6:162553364-162553386 AAGAGGCAGGGGAGGGTGGGAGG + Intronic
1018429720 6:163713466-163713488 GGTAGGGAGGAGAGGGTGGGGGG - Intergenic
1018627164 6:165791213-165791235 CGTTGGAAGGGCAAGGTGGGAGG + Intronic
1018866049 6:167747774-167747796 AGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1018910053 6:168096598-168096620 CCCAGGAAGGGGAGAGGAGGCGG + Intergenic
1019113714 6:169739288-169739310 CATGGGAAGGCCAGGGTGGGAGG - Intergenic
1019255958 7:51161-51183 GCTGGGAAGGGGAGGGAGAGGGG + Intergenic
1019287366 7:230360-230382 CCCAGGACGGGGTGGGGGGGGGG + Intronic
1019334389 7:476150-476172 CCAAGGGAGGCCAGGGTGGGAGG + Intergenic
1019405843 7:883708-883730 CCGAGGCCGGGGAGAGTGGGGGG - Intronic
1019446769 7:1075268-1075290 CTTAGGAAGGCCAAGGTGGGCGG + Intronic
1019465429 7:1185600-1185622 CCACGGAGGGGGAGGGTGGACGG - Intergenic
1019473048 7:1231423-1231445 CCTGGGCCGGGGAGGGTGGGGGG - Intergenic
1019728630 7:2617352-2617374 CCTGGGAAGGGAAGGGCTGGTGG - Intergenic
1019781399 7:2942338-2942360 GTAAGGAAGGGGAGGGAGGGAGG - Intronic
1020383369 7:7569752-7569774 ACTAGGGAGGGGATGGAGGGTGG + Intronic
1021112440 7:16710617-16710639 GGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1021241219 7:18203739-18203761 ACTAGGAAGTGGTGTGTGGGAGG - Intronic
1022046789 7:26628050-26628072 CCCAGGCCGGGGAGGGAGGGAGG + Intergenic
1022396981 7:29997861-29997883 ACTAGGAAGGGTGAGGTGGGAGG - Intergenic
1022410370 7:30135088-30135110 CCTAGGAGCGGGAGGGCGGGCGG + Exonic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1022567252 7:31415864-31415886 CCTGAGAAGGGCAGGGTGGAGGG - Intergenic
1022895127 7:34742314-34742336 ACTTGAAAGTGGAGGGTGGGAGG - Intronic
1023065318 7:36371850-36371872 ACTTGGAAGGCCAGGGTGGGAGG - Intronic
1023179326 7:37465815-37465837 CTTTGGAAGGCCAGGGTGGGTGG + Intergenic
1023857010 7:44190106-44190128 GCTGCGAAGGGGAGAGTGGGTGG - Intronic
1024243667 7:47454066-47454088 CCAAGGGAGGGGAGGTGGGGAGG + Intronic
1025735396 7:64142595-64142617 ACTAGGAAGGCCAAGGTGGGAGG - Intronic
1026105744 7:67419363-67419385 CCTGGGTAGGGGTGGGTGGTGGG + Intergenic
1026482015 7:70787501-70787523 GCTGGGACAGGGAGGGTGGGCGG - Intronic
1026665995 7:72340314-72340336 CTTTGGAAGGTGGGGGTGGGAGG - Intronic
1026846074 7:73699845-73699867 CCTAGGCAGGGGAGGGAGCCTGG + Exonic
1026933118 7:74236184-74236206 CCTGGGTGGGGCAGGGTGGGTGG - Intronic
1027195101 7:76024506-76024528 ACTGGGAAGGGTAAGGTGGGAGG + Intronic
1027655899 7:80930447-80930469 CCATGAAAGGGGAGTGTGGGGGG - Intergenic
1027923345 7:84426069-84426091 CTCAGGAAGGGAAGGGTGGGAGG + Intronic
1028053209 7:86209258-86209280 ACTTGGAAGGGGTGGGTGGGGGG + Intergenic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029255522 7:99266970-99266992 CCAAGGTAGGGTATGGTGGGCGG + Intergenic
1029496857 7:100900084-100900106 CATAGGAAGGGGTGGGTAGAGGG - Intergenic
1029974178 7:104817060-104817082 GCTAGGAAGGCCAGGGTGTGTGG - Intronic
1030056219 7:105586030-105586052 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030176643 7:106661018-106661040 CCTCGGAGGGGGAGGGGCGGCGG - Intergenic
1030185257 7:106755385-106755407 ACTTGATAGGGGAGGGTGGGAGG + Intergenic
1030234847 7:107247214-107247236 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030399494 7:109030804-109030826 CATAGGAAAGGAAGGGTGTGGGG - Intergenic
1030679446 7:112419364-112419386 GCTAGGAAGGGTAGTGGGGGTGG + Intergenic
1030786412 7:113668802-113668824 ACTAGAAAGGGGAGGGAAGGAGG + Intergenic
1030924560 7:115435868-115435890 ACTAGAGAGGGGAGGGAGGGAGG + Intergenic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1031769956 7:125830573-125830595 CCTAGAAACGGGAGGCTAGGAGG - Intergenic
1031870294 7:127083596-127083618 CTTAGGAAAGGGATGATGGGGGG - Intronic
1032996724 7:137455203-137455225 CCTGAGAAGGGTGGGGTGGGAGG - Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033325599 7:140375223-140375245 CCTTGGAAGGCGGGGGCGGGTGG + Intronic
1033354888 7:140591826-140591848 AGAAGGAAGGGGAGGGAGGGAGG - Intronic
1034882391 7:154772491-154772513 GCCAGGAAGGGGAGAGTTGGAGG - Intronic
1034989221 7:155537246-155537268 CCTCGGAAGGAGAGGCTGGAAGG - Intergenic
1035034417 7:155885740-155885762 CCTGGGAAGGGAAGGGCAGGAGG - Intergenic
1035130411 7:156647345-156647367 CTCAGGAGGCGGAGGGTGGGAGG - Intronic
1035195472 7:157216501-157216523 ACTTGAAGGGGGAGGGTGGGAGG - Intronic
1035416886 7:158696719-158696741 CTTAGGAGGAGGAGGGTGGCAGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035564003 8:629173-629195 GCTAGGAAGGGGGTGCTGGGTGG - Intronic
1035754889 8:2023735-2023757 GCTAGGAAGGGGAGCGTGAAGGG + Intergenic
1035782512 8:2239655-2239677 CCCAGAGAGGGGAGGGTGGCAGG - Intergenic
1035809608 8:2479933-2479955 CCCAGAGAGGGGAGGGTGGCAGG + Intergenic
1036380171 8:8231550-8231572 CCTAGGATGGGCTGGGTGGGTGG - Intergenic
1036787831 8:11699541-11699563 CCTTGGATGGGGAGGGAGAGAGG + Intronic
1036849390 8:12191112-12191134 CCTAGGATGGGCTGGGTGGGTGG + Intronic
1036870750 8:12433385-12433407 CCTAGGATGGGCTGGGTGGGTGG + Intronic
1037242193 8:16790162-16790184 CCTTGGAAGGTGGAGGTGGGAGG + Intergenic
1037390389 8:18386714-18386736 CCTTGGTACGGGTGGGTGGGAGG - Intergenic
1037486301 8:19350590-19350612 ACTCGGGAGGCGAGGGTGGGAGG - Intronic
1037748215 8:21663016-21663038 GCTTGGTAGGGGAGGGTGGGGGG - Intergenic
1038022861 8:23564495-23564517 GGGAGGAAGGGAAGGGTGGGAGG + Intronic
1038084592 8:24180522-24180544 CCTAAGAAGGTGGGGGTGGGGGG + Intergenic
1038158288 8:25011962-25011984 ACTAGGAAGGGGAGGCTGGAGGG - Intergenic
1038389858 8:27186570-27186592 CCTAGGGAGGCTAAGGTGGGAGG - Intergenic
1038414173 8:27381336-27381358 GCTGGGAAGGGCAGGGTGGAAGG - Intronic
1038568616 8:28640442-28640464 CTTAGGAAGGGGAGGCTCAGAGG + Intronic
1038855384 8:31325522-31325544 CCTTGGGAGGCCAGGGTGGGAGG - Intergenic
1039294695 8:36137682-36137704 CCTTGGGAGGCGAAGGTGGGAGG + Intergenic
1039518848 8:38154117-38154139 CCTGGGAGGGGGTGGTTGGGAGG + Intergenic
1039556175 8:38476833-38476855 CCAAGGAAAGGGAGGGGTGGGGG - Intergenic
1039619461 8:38983291-38983313 CTTTGGAAGGCCAGGGTGGGTGG + Intronic
1039771992 8:40696801-40696823 CCTTGGCAGGGGAGAGTGGGAGG - Intronic
1039824495 8:41161519-41161541 TCTAGGAGGTGGAGGGTGGACGG - Intergenic
1039945324 8:42123820-42123842 CCCTGGGAGGGGAGGGTGGCTGG - Intergenic
1040719856 8:50306044-50306066 CTCAGAAGGGGGAGGGTGGGAGG - Intronic
1040918078 8:52584511-52584533 ACTTGGAAGGCTAGGGTGGGAGG - Intergenic
1041007290 8:53507962-53507984 GGTGGGAAGTGGAGGGTGGGAGG - Intergenic
1041170862 8:55141125-55141147 GCTGGGAAGGCGTGGGTGGGAGG - Intronic
1042209620 8:66366742-66366764 GTAAGGAAGGGGAGGGTGGCAGG - Intergenic
1043408921 8:79971519-79971541 CCTAGGGATGGGAAGATGGGAGG - Intronic
1043908335 8:85833088-85833110 ACGGGGAAGGGAAGGGTGGGAGG - Intergenic
1043962265 8:86430518-86430540 CCTTGGGAGGGCAAGGTGGGAGG - Intronic
1044341881 8:91055254-91055276 CCTTGGAAGGCCGGGGTGGGCGG + Intergenic
1044869735 8:96607120-96607142 TCCATGAATGGGAGGGTGGGGGG - Intronic
1045447583 8:102283325-102283347 CTTAGGAAGGGGAAGGCGGGGGG + Intronic
1045483619 8:102612763-102612785 CCTAGGAATGGCATGGTGGTGGG + Intergenic
1045592905 8:103618316-103618338 ACTTGAATGGGGAGGGTGGGAGG + Intronic
1045666967 8:104498371-104498393 TCTAGGGAGGGTGGGGTGGGAGG - Intronic
1046913850 8:119658990-119659012 CCTAGGTTGGGGAGGGATGGAGG - Intronic
1046958172 8:120083036-120083058 CTTAGGAAAGGGAGGGAGGAAGG + Intronic
1047246717 8:123152476-123152498 GCTAGGAAGTGGAGGGAGGGAGG - Intergenic
1047698117 8:127423391-127423413 CCAGGGAAGTGGAGGGTGGAAGG + Intergenic
1048096732 8:131303835-131303857 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1048124711 8:131621024-131621046 ACTAGAGAGGGGAGGGAGGGAGG + Intergenic
1048743221 8:137585389-137585411 CCTAAGAAGGGGAGGGTTCTAGG + Intergenic
1048915733 8:139181292-139181314 ACTAGGTAGGGCAGGGTGGGGGG + Intergenic
1049162555 8:141106460-141106482 CCACGGCAGGGGAGGTTGGGTGG + Intergenic
1049277042 8:141725160-141725182 CACAGGAAGGGGTGGGTGGCGGG - Intergenic
1049415968 8:142495291-142495313 CATGGGAAAGGGTGGGTGGGCGG + Intronic
1049426562 8:142540522-142540544 CCTCAGAGCGGGAGGGTGGGCGG + Intronic
1049501886 8:142971454-142971476 CCTAGCAGGGTGTGGGTGGGAGG + Intergenic
1049501911 8:142971553-142971575 CCTAGGGGAGGGAGGCTGGGTGG - Intergenic
1049777582 8:144413690-144413712 CGTGGGAAGGGGTCGGTGGGAGG + Intronic
1049833660 8:144718805-144718827 CTTTGGAAGGGCAAGGTGGGTGG + Intergenic
1049854028 8:144850409-144850431 ACAGGGAAGGGGAGGGTGTGAGG + Exonic
1050366365 9:4877221-4877243 TCGAGGGAGGGGAGGGAGGGGGG + Intronic
1050736048 9:8764552-8764574 CTTAGGAAGGCCAAGGTGGGTGG + Intronic
1051196406 9:14566630-14566652 CCTAGGAAGGCAGGGGTGGGCGG + Intergenic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1051847734 9:21471148-21471170 CCTAGGGAGAGGAGGGAGAGTGG + Intergenic
1052090092 9:24317130-24317152 CCTGGGAAGGTCCGGGTGGGAGG - Intergenic
1053409115 9:37904201-37904223 CCGAGGGAGGGGAGGCGGGGCGG - Intronic
1053428225 9:38025159-38025181 CCTTGTAAGGGGAGGTAGGGGGG - Intronic
1053472236 9:38355130-38355152 AGAAGGAAGGGGAGGGAGGGAGG + Intergenic
1053559901 9:39181082-39181104 ACTTGGAAGGGGGAGGTGGGAGG + Intronic
1053824010 9:42001303-42001325 ACTTGGAAGGGGGAGGTGGGAGG + Intronic
1053913788 9:42929964-42929986 TGTGGGAAGGGGAGGGTTGGAGG + Intergenic
1054137215 9:61437873-61437895 ACTTGGAAGGGGGAGGTGGGAGG - Intergenic
1054606563 9:67186060-67186082 ACTTGGAAGGGGGAGGTGGGAGG - Intergenic
1054797585 9:69316942-69316964 GCTGGGATGGGGAGGGTGAGTGG - Intergenic
1055018063 9:71640405-71640427 CCTGAGAAGGGGAGAGTGGGTGG - Intergenic
1055299860 9:74871786-74871808 ACTCGGGAGGTGAGGGTGGGAGG - Intronic
1055322695 9:75097964-75097986 CCTGGGAAGGCTAAGGTGGGAGG - Intronic
1055481451 9:76712476-76712498 GCTAGGATGGGGAGGGTGGGTGG + Intronic
1055579532 9:77692912-77692934 TCTAGGAAGGGTAGTGGGGGTGG - Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1056158818 9:83867430-83867452 CCTAGGGATGGGTGGGAGGGTGG - Intronic
1056351750 9:85756482-85756504 CCTAGGGATGGGTGGGAGGGTGG + Intergenic
1056507698 9:87272963-87272985 CCTTGAAGGTGGAGGGTGGGAGG + Intergenic
1056756640 9:89385868-89385890 CCTTGGCAGGGGTGGGTGGGCGG - Intronic
1057302969 9:93896992-93897014 CCTAGGAAGAGGAGGCTCAGGGG + Intergenic
1057446949 9:95123056-95123078 CCTTGGGAGGGCAAGGTGGGAGG + Intronic
1057643413 9:96850488-96850510 ACCAAGAAGGGGAGGGTGGGAGG + Intronic
1058057028 9:100458748-100458770 CTTGGGAAGGCGAAGGTGGGAGG + Intronic
1058484196 9:105427009-105427031 CCTAGGAGGCGGAGGTTGGAGGG - Intronic
1058530517 9:105901245-105901267 CCTCAGAAGAGGAGGGTAGGGGG + Intergenic
1059034418 9:110738673-110738695 CCCCAGAAGGGGTGGGTGGGAGG + Intronic
1059266644 9:113038672-113038694 ACTAGGAAGGCTAAGGTGGGAGG + Intronic
1059847236 9:118293805-118293827 CCTAGAAAGGGTCGGGGGGGTGG + Intergenic
1060080617 9:120640853-120640875 ACTAGAAGGGGGAGGGTGGGCGG - Intronic
1060123982 9:121024210-121024232 ACTCGGGAGGGGAGGGAGGGAGG + Intronic
1060415011 9:123424016-123424038 CCTAGGCTGGGGAGAGGGGGTGG + Intronic
1060602811 9:124889303-124889325 CCTAGGTCGGGGAGGAGGGGAGG + Exonic
1060751221 9:126170713-126170735 CCCAGGAAGGAGAGGATGGGAGG + Intergenic
1060936942 9:127521545-127521567 GCCAGGAAGTGGGGGGTGGGGGG - Intronic
1060976181 9:127766511-127766533 CCCAGGAGGGGCATGGTGGGAGG - Intronic
1061233473 9:129328444-129328466 CCCTGGAAGGGGAGGGAGGAAGG + Intergenic
1061284865 9:129616457-129616479 CTTAGGAAGGCGAAGGGGGGTGG - Intronic
1061395984 9:130343528-130343550 CCTGGGTCGGGGAGGGTCGGGGG - Intronic
1061402936 9:130378333-130378355 GCTGGGAAGGGGAGGCTGAGAGG + Intronic
1061402951 9:130378377-130378399 GCTGGGATGGGGAGGCTGGGAGG + Intronic
1061402984 9:130378448-130378470 GGTAGGAAGGGGAGGCTGGGAGG + Intronic
1061566612 9:131444883-131444905 CCTTGGAAGCCGAGGGTGGCTGG + Intronic
1061765546 9:132878889-132878911 ACTTGGGAGGCGAGGGTGGGTGG - Exonic
1061773753 9:132946745-132946767 CCAAGGAAGGTCAGGGTGTGGGG - Intronic
1061792658 9:133066713-133066735 AACGGGAAGGGGAGGGTGGGAGG + Intronic
1061802373 9:133119669-133119691 CCTGGGAGGGTGGGGGTGGGAGG - Intronic
1061895173 9:133643355-133643377 GCTGGGGAGGGGAGGGTGGGCGG + Intronic
1061999000 9:134206662-134206684 GAGAGGAAGGGGAGGGTGGGAGG + Intergenic
1062600168 9:137315925-137315947 CCTGGGATGGGGACGGTGTGGGG - Intronic
1202629531 M:5202-5224 CCTAGGGAGAGGAGGGTGGATGG - Intergenic
1203472075 Un_GL000220v1:119620-119642 CCAAGGAAGGGGAGAGAGGGAGG - Intergenic
1185485863 X:481580-481602 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185485880 X:481635-481657 CGGAGGAAGGAGAGGGAGGGAGG + Intergenic
1185640771 X:1588404-1588426 CGAAGGGAGGGGAGGGGGGGAGG - Intergenic
1185772611 X:2776245-2776267 TTTAGGAAGGGGAGGGCTGGGGG + Intronic
1185785902 X:2890648-2890670 TTTAGGAAGGGGAGGGCGGGGGG + Intergenic
1185843942 X:3419533-3419555 GCTTGAAGGGGGAGGGTGGGAGG - Intergenic
1185889483 X:3811522-3811544 CCTCGGGAGGGGAGGAGGGGAGG + Intergenic
1185931102 X:4204329-4204351 CCAAAAAAGGGGAGGGTGGCAGG + Intergenic
1186020597 X:5251145-5251167 GGGAGGAAGGGGAGGGAGGGAGG + Intergenic
1186139201 X:6553280-6553302 CCTAGAACGGGGAGAGAGGGAGG + Intergenic
1187568766 X:20479030-20479052 ACTCAGAAGGGAAGGGTGGGAGG + Intergenic
1187841166 X:23490059-23490081 GCTGGGAAGGGGAGGGGGGAGGG + Intergenic
1187876711 X:23810019-23810041 CCTTGGAAGGCCAAGGTGGGAGG + Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188405106 X:29797795-29797817 CCTGGGAAGCGGAGGTTGTGGGG + Intronic
1188699183 X:33237167-33237189 GGGAGGAAGGGGAGGGAGGGAGG - Intronic
1188938975 X:36213909-36213931 ACAAGGAAGGGAAGGATGGGAGG + Intergenic
1188984573 X:36757733-36757755 CCTAGGAAGGACATGGTAGGAGG - Intergenic
1189232976 X:39466416-39466438 CCTAGGAAGCAGTGAGTGGGGGG - Intergenic
1189332944 X:40154249-40154271 CCTGGGGAGGGGAGGGGGCGAGG - Intronic
1189402829 X:40688139-40688161 CCTAGGAGGCAGAGGTTGGGAGG + Intronic
1189692637 X:43633072-43633094 CCAAGGAAGGGGTTGGAGGGAGG + Intergenic
1190224108 X:48532491-48532513 CATAGGAATTGGAGGTTGGGGGG + Intergenic
1190306593 X:49086476-49086498 CCTGGGCATGGGTGGGTGGGTGG + Intronic
1190712008 X:53078214-53078236 ACTTGGAAGGGGAGGGTGCATGG - Exonic
1190915266 X:54807660-54807682 CCGAGGAAGGCGAGGGGGGGTGG + Exonic
1191206434 X:57838725-57838747 ACTTGAAAGTGGAGGGTGGGAGG - Intergenic
1191758785 X:64624591-64624613 CACAGGAAGGGGAGGTTGGGAGG - Intergenic
1191867209 X:65713777-65713799 CATAGAAGGTGGAGGGTGGGAGG - Intronic
1192122221 X:68467167-68467189 CCTCGGGAGGCTAGGGTGGGAGG + Intergenic
1192175202 X:68880921-68880943 CCTGGGAAGGGGGGGCAGGGAGG - Intergenic
1192400897 X:70834510-70834532 CCTAGGGAGGCCAAGGTGGGTGG + Intronic
1194089906 X:89572924-89572946 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1194374726 X:93118116-93118138 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1195177095 X:102322168-102322190 GCAAGGAATGGCAGGGTGGGCGG - Intronic
1195181769 X:102364925-102364947 GCAAGGAATGGCAGGGTGGGCGG + Intronic
1195310703 X:103629407-103629429 CCCAGAAAGTGGGGGGTGGGGGG + Intronic
1195702639 X:107716548-107716570 CCTGGGAAGGGGCGGGGGGGAGG - Intronic
1195741953 X:108073847-108073869 CCTAGATAGGGGTGGTTGGGAGG - Intronic
1196711116 X:118764181-118764203 GCTGGGAAGGTGGGGGTGGGGGG - Intronic
1197045067 X:121986447-121986469 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
1197261136 X:124319468-124319490 GCCAGGAAGGGCAGGGAGGGGGG + Intronic
1197758129 X:130010420-130010442 TCGGGGAAGGGGAGGGAGGGAGG - Intronic
1198529662 X:137538999-137539021 CCTGGGAAGAGGAGGTGGGGAGG + Intergenic
1198596402 X:138240781-138240803 CCGGTGAAGGGCAGGGTGGGGGG - Intergenic
1198676446 X:139136347-139136369 CTCAGAACGGGGAGGGTGGGGGG - Intronic
1198880742 X:141278406-141278428 CCTAGGGAGGGTAGAGTGTGAGG - Intergenic
1199137059 X:144266032-144266054 TGTAAAAAGGGGAGGGTGGGTGG - Intergenic
1199927350 X:152481040-152481062 CGCAGGAGGGGCAGGGTGGGAGG - Intergenic
1200116609 X:153772310-153772332 CCTACGCAGGGGAGGGTAGGAGG + Intronic
1200135221 X:153871454-153871476 CCTAGGAAAGGACGGGTGGGGGG + Intronic
1200215325 X:154365702-154365724 CTTGGAAGGGGGAGGGTGGGGGG - Intronic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200243197 X:154508347-154508369 CCTAGTTGGGGGGGGGTGGGGGG + Exonic
1200341056 X:155395996-155396018 ACTTGAAAGTGGAGGGTGGGAGG + Intergenic
1200414189 Y:2890691-2890713 ACTTGGAAGGCTAGGGTGGGAGG + Intronic
1200442557 Y:3228978-3229000 CTCAGAAGGGGGAGGGTGGGAGG - Intergenic
1200682750 Y:6232182-6232204 TCTTGGAGGTGGAGGGTGGGAGG + Intergenic
1200819577 Y:7568645-7568667 ACTTGAAGGGGGAGGGTGGGAGG + Intergenic
1201669006 Y:16494451-16494473 TATAGGAAGGTGAGGGTGGGAGG - Intergenic
1202627119 Y:56871089-56871111 CCGTGGAAGGGGAGGAGGGGTGG - Intergenic