ID: 1008876381

View in Genome Browser
Species Human (GRCh38)
Location 6:56334201-56334223
Sequence CCATGTTTCTGGAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 305}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1008876381_1008876391 22 Left 1008876381 6:56334201-56334223 CCATCTGCCCTCCAGAAACATGG 0: 1
1: 0
2: 3
3: 38
4: 305
Right 1008876391 6:56334246-56334268 TTAGTAGCACCAGCATGAACTGG 0: 1
1: 0
2: 1
3: 9
4: 132
1008876381_1008876392 23 Left 1008876381 6:56334201-56334223 CCATCTGCCCTCCAGAAACATGG 0: 1
1: 0
2: 3
3: 38
4: 305
Right 1008876392 6:56334247-56334269 TAGTAGCACCAGCATGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1008876381 Original CRISPR CCATGTTTCTGGAGGGCAGA TGG (reversed) Intronic
900122244 1:1053738-1053760 CCTTCTCGCTGGAGGGCAGAGGG - Exonic
900236641 1:1594749-1594771 CCATGGAGCTGGAGCGCAGATGG - Intergenic
900461524 1:2804348-2804370 TCAGGTGTCTGGAGGGCAGGGGG - Intergenic
900646015 1:3709038-3709060 CCACGCTCCTGGAGGGCCGAGGG + Intronic
900678042 1:3900705-3900727 CCATGTTTGAGAGGGGCAGACGG + Intergenic
901455125 1:9358741-9358763 GCATGTTCCTGGAGGGCACAGGG - Intronic
901840832 1:11952906-11952928 TCATGGTTCTGGAGGCCGGAAGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904696600 1:32335090-32335112 CCATTCTCCTGCAGGGCAGAGGG + Exonic
904808763 1:33149956-33149978 CCATGTTTGTGTTGGGCAGGTGG + Intronic
904881975 1:33707169-33707191 CCAGGTTGCTGGAGGTCATATGG - Intronic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
905912827 1:41665313-41665335 CCATGTATCTGAAAGGCAGGTGG + Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908207666 1:61868013-61868035 CTATATTTGTGGAGGGCAAATGG + Intronic
908404942 1:63805399-63805421 ACATGTTTCTGGAGGTAGGAAGG - Intronic
908821719 1:68093755-68093777 CCATTTTTCTGGTGGGGGGAGGG - Intergenic
909691256 1:78410020-78410042 CCACTTTTCTGTAGGGCAGCTGG - Intronic
909695689 1:78465724-78465746 CCATTTTTCTGTAAGGCAGCTGG + Intronic
910083060 1:83364732-83364754 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
911139875 1:94488145-94488167 TCATGTTTCTTGAGGACAGCTGG + Intronic
911230636 1:95357646-95357668 CCATGAGTCTGGAGGGGACATGG + Intergenic
911818689 1:102387876-102387898 ACATATTTCTGGAGTGCACATGG - Intergenic
912567678 1:110599909-110599931 CCAGGTTTCTGGTGGGAGGAAGG + Intronic
913330516 1:117663312-117663334 TCTTGTATCTGGAGGGCAGTGGG - Intergenic
913609229 1:120493995-120494017 ACATGTTTCTGTGGGGCTGAGGG + Intergenic
914581963 1:149027844-149027866 ACATGTTTCTGTGGGGCTGAGGG - Intronic
915302448 1:154959308-154959330 CCAGGTCTCTGGAGAGGAGAAGG + Exonic
915734879 1:158078401-158078423 CCTTGTTTCTAAAAGGCAGAAGG - Intronic
916745409 1:167681311-167681333 TAATGTGCCTGGAGGGCAGACGG + Intronic
917336523 1:173929269-173929291 TCATCTTGCTGGAGGGCAAAGGG + Intergenic
917719286 1:177770815-177770837 CCTTCTTTTTGGAGGGTAGAGGG + Intergenic
919602610 1:199641053-199641075 CCATGGTTCTGGATGGAGGAGGG + Intergenic
919847919 1:201653262-201653284 CCCTTTTCCTGGAGGACAGAAGG - Intronic
920416839 1:205804551-205804573 CCAAGTTGCTCCAGGGCAGATGG - Intronic
1064927450 10:20584806-20584828 TCATGTTTCTGGGGGAGAGATGG - Intergenic
1067689876 10:48494855-48494877 CAAAGTTTCTGGTGGGAAGAGGG - Intronic
1067725951 10:48771093-48771115 CCATGTGTTTGGAAGGCAGGCGG + Intronic
1068100545 10:52547207-52547229 CCATGGGTATGGAGGGCTGACGG - Intergenic
1068931624 10:62596220-62596242 CCATCTGCATGGAGGGCAGAAGG - Intronic
1069780356 10:70951552-70951574 CCTTATTTATGGAGGGCAGAGGG - Intergenic
1070907397 10:80085135-80085157 CAATTTTTTTGAAGGGCAGAGGG + Intronic
1071478117 10:86042184-86042206 CCATCTTTCTGGAAGGAAGGTGG - Intronic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1073200101 10:101728304-101728326 CTGTGTTTATGGAGGACAGAGGG - Intergenic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1077037696 11:503250-503272 CCGTCTTTCTGAAGGGCAGCTGG - Exonic
1077259527 11:1608382-1608404 CCATGGTTCTGGTGGGTTGAGGG + Exonic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1078095050 11:8291689-8291711 CCCTGTTTCCGGAGGGCAGGTGG + Intergenic
1079014422 11:16856580-16856602 CCATGTTTCTGGGATGCTGATGG - Intronic
1079391299 11:20024217-20024239 GCTTGTTTCTGGAAGGAAGAGGG + Intronic
1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG + Intronic
1084288443 11:68146671-68146693 CCATGTGGCTGGAGGGCTCAGGG + Intergenic
1084800083 11:71538037-71538059 CCATGGTTCTGGTGGGTTGAGGG - Exonic
1085453573 11:76653640-76653662 GCATGTTTCTGGAGTGAATAAGG - Intergenic
1086700994 11:89900325-89900347 CTAAGTTTCTGGACGGCAGAGGG + Intergenic
1086705173 11:89944202-89944224 CTAAGTTTCTGGACGGCAGAGGG - Intergenic
1088618707 11:111660264-111660286 CCTTGTATCTGGAGGGTGGAAGG + Intronic
1088767737 11:113000695-113000717 CCCTGTTCCTGGAAGGCTGATGG + Intronic
1089230235 11:116967826-116967848 CCATGTTCCTGATGGGCACAGGG - Intronic
1089310701 11:117556376-117556398 GAAGGTTTCTGGAGGGGAGAAGG + Intronic
1089345545 11:117789093-117789115 CCATGTTTCTGATGGACACAGGG - Intronic
1091290803 11:134438708-134438730 CCATGATTCAGGAGGGCAAAAGG - Intergenic
1091807268 12:3365724-3365746 CCATGTCCCGGGAGGGCACACGG + Intergenic
1095254521 12:40018991-40019013 ACATGTTTCTGAAGAGGAGAGGG + Intronic
1096088761 12:48884083-48884105 GAATGTTTATGGAAGGCAGAGGG + Intergenic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1096714332 12:53482362-53482384 CCACGTTTCTGCAGGAGAGATGG + Exonic
1097477939 12:60082559-60082581 CAATGTTTCAGGAGAACAGAGGG - Intergenic
1098434055 12:70450451-70450473 CCATGGTTGTGCAGGGCAGCAGG - Intergenic
1099426495 12:82530278-82530300 CCATGTTTCTGAATGGAAGAGGG - Intergenic
1100823624 12:98454986-98455008 CCACGAGTCTGGAGGGCAGCTGG - Intergenic
1102819735 12:115897475-115897497 CCCTGATTCTGGAGGCCAGGTGG + Intergenic
1104003711 12:124877475-124877497 CCTTCTTTCTTGAAGGCAGAGGG + Intronic
1104089823 12:125506971-125506993 CCAAACTTCTGCAGGGCAGAGGG + Intronic
1107192886 13:37610892-37610914 CCATGTATCTGGAGAGCAAGAGG + Intergenic
1108647783 13:52448115-52448137 TGATGTTTCTGGAGCACAGAAGG - Intronic
1112458372 13:99582183-99582205 CCATGTTTCTGGAAGTGAAAGGG + Intergenic
1113789261 13:113018918-113018940 CCAGGTTCCTGGATGGCTGATGG - Intronic
1113813637 13:113157320-113157342 CCAAGCTCCAGGAGGGCAGAGGG - Intergenic
1114039263 14:18661058-18661080 CGATTTTTTTGAAGGGCAGAGGG + Intergenic
1114141829 14:19920921-19920943 CCTTTTTACTGGAGGGGAGATGG + Exonic
1117621256 14:57589413-57589435 CCATGGTTCTGAAGGGCATCTGG - Exonic
1117906214 14:60591231-60591253 TCATGTTTCTGGCAGGCAGAAGG - Intergenic
1118332499 14:64825102-64825124 ACAGGTTTCAGGAGGGCAGCTGG + Intronic
1119123500 14:72101583-72101605 TCATGTTTCTTCAAGGCAGAGGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120885599 14:89449638-89449660 CCACGTTTTTGGGGGGCAGGAGG + Intronic
1121712987 14:96053007-96053029 CCCGGTTTCTGCAGGGCTGAGGG + Intronic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1124091980 15:26613982-26614004 TGATGTTTCTGAAGAGCAGAAGG + Intronic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1126146444 15:45477826-45477848 GCTTGATTCTGGAAGGCAGATGG - Intergenic
1126186445 15:45835166-45835188 CCAAGATTCTGCAGGGCAGATGG - Intergenic
1126334232 15:47569321-47569343 GCATGATTCTAGAGGACAGAGGG - Intronic
1126792581 15:52234642-52234664 CCCTGTCTCTGTAGGGCTGATGG - Intronic
1127110907 15:55669396-55669418 TGATGTGTCTGGAGGGCAGTAGG - Intronic
1128869048 15:71138455-71138477 CCAGATTTCTGGGGGACAGAAGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129854240 15:78812222-78812244 CCATGTTTAGTGACGGCAGAAGG - Intronic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130814694 15:87419122-87419144 CCATGTTACTGGAACACAGAAGG - Intergenic
1131809925 15:96162473-96162495 ATATTTCTCTGGAGGGCAGAGGG - Intergenic
1132815441 16:1824008-1824030 ACAGCTTGCTGGAGGGCAGATGG - Intronic
1132880178 16:2158668-2158690 CCCTGCTGCTGCAGGGCAGAAGG + Intronic
1133381124 16:5331412-5331434 TCATGTGTCTGGAGGTCAGGTGG + Intergenic
1134000520 16:10779429-10779451 CCATGTTGCTGGGGAGCAGGAGG - Intronic
1134899849 16:17927596-17927618 CCATCAGTCTGGAGGGCAGAGGG + Intergenic
1135094721 16:19555623-19555645 CCATGTTTGTGAAGGGCAGCTGG - Exonic
1135938955 16:26804289-26804311 GCTTGTTTCTGGAGGCCACATGG - Intergenic
1137408062 16:48205621-48205643 CCAAGGTCCTGGAGGGCAGTGGG - Intronic
1137669749 16:50272194-50272216 TCATGTCCCTGGAAGGCAGAAGG + Intronic
1138207099 16:55133150-55133172 CCATTTAGGTGGAGGGCAGAGGG + Intergenic
1138223852 16:55276016-55276038 CCATGTGACTGGCGGGCAGGCGG + Intergenic
1138569660 16:57861616-57861638 CCATGGTACTGGGGGCCAGAAGG + Intronic
1140315164 16:73889302-73889324 CCATGTTTTTGGCAGGCAAAGGG + Intergenic
1141506471 16:84481600-84481622 CCCTGTTTCTGCAGAGCTGAGGG - Intronic
1143056215 17:4163773-4163795 CAAACTTTCTGGAGGGCAGCTGG + Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143188789 17:5026304-5026326 CAAGTTTTCTGGAGGTCAGAGGG + Exonic
1143529389 17:7493207-7493229 CCATGTTTCAGGCAGGCACATGG + Intronic
1143883684 17:10050483-10050505 CCAGGTTTAGGGTGGGCAGAGGG - Intronic
1144223442 17:13121062-13121084 ACATGTTCCAGGAGGGCAGCTGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144827725 17:18115772-18115794 CCAGGTGGCTGGAGGGCAGTGGG - Intronic
1146635613 17:34502103-34502125 GAATGGATCTGGAGGGCAGATGG + Intergenic
1146707241 17:35010183-35010205 TCATGACTCTGGATGGCAGAGGG - Exonic
1147909157 17:43844487-43844509 CCATGCTTCTGGTGGGAAGCAGG + Intergenic
1148111497 17:45147127-45147149 CCCTGTTTATGGAGGGCTGGGGG + Intergenic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1149990265 17:61379304-61379326 CCATGTTTCGAGAAGGCAGAGGG - Intronic
1150227904 17:63533758-63533780 CCACGGCTCTGGTGGGCAGAGGG - Intronic
1151429076 17:74050410-74050432 CCAAGTCTCTGGCGGGCAGTAGG + Intergenic
1151516546 17:74599844-74599866 ACAAGTTGCTGGAGGGCAGCTGG + Intergenic
1152014826 17:77743727-77743749 CCATTTTGCAGAAGGGCAGATGG + Intergenic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152342394 17:79732474-79732496 GCATGCTTCTGGAGGCCAGAAGG + Intronic
1152647520 17:81476374-81476396 CCATCTATCTGGTGGGGAGAGGG - Intergenic
1152997478 18:421249-421271 CCATGTTAATAGAGAGCAGATGG + Intronic
1156377630 18:36529039-36529061 GAGGGTTTCTGGAGGGCAGATGG + Intronic
1157521722 18:48349933-48349955 CCCTGTTTATGAAGGGCAGGTGG - Intronic
1158459111 18:57632366-57632388 ACATGTTTCAGGAGAGCACAGGG + Intergenic
1158868594 18:61662055-61662077 CCATTATTCTGGAGGTCACAAGG + Intergenic
1159122519 18:64187295-64187317 CCATGGCTCTGGAGGGACGAGGG - Intergenic
1160018745 18:75164332-75164354 TGCTGTTTCTGGAGCGCAGAGGG + Intergenic
1160486321 18:79296304-79296326 CCATGTTACTGCAGCCCAGAAGG + Intronic
1161271177 19:3390175-3390197 CCAGGTGTCTGGACAGCAGAGGG + Intronic
1162243755 19:9381385-9381407 ACATGTTTCTGAAGGGATGAAGG - Exonic
1162760080 19:12883732-12883754 CCATTATTCTGGAGGTCACAAGG + Intergenic
1164108553 19:22133130-22133152 CTATTTTTCTGCAGGTCAGAGGG + Intergenic
1164486259 19:28658149-28658171 CCAAGTTTCTGGAAGGGAGAGGG - Intergenic
1164593388 19:29518315-29518337 CCATGGGTCTGGAGAGCACAAGG + Intergenic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1166672010 19:44716046-44716068 CCATTCTTCAGCAGGGCAGAGGG + Intergenic
1166674538 19:44731998-44732020 CTATGTCTCCGGAGGGCAGGTGG + Intergenic
1168081382 19:54012729-54012751 GTATGTTTCTGGAGGGAATATGG - Intergenic
925104411 2:1278245-1278267 TATTGTTTATGGAGGGCAGAAGG + Intronic
925493266 2:4419183-4419205 CCTGAGTTCTGGAGGGCAGAGGG + Intergenic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
926978032 2:18534404-18534426 CCAAGTTACTTGAGGTCAGATGG + Intergenic
927956687 2:27212010-27212032 CCATGTTTACTGAGGGCGGATGG + Exonic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
929169920 2:38921306-38921328 GCATGTATCTGGAGGGGATAGGG + Intronic
929763612 2:44826212-44826234 AGATTTGTCTGGAGGGCAGAAGG - Intergenic
930010189 2:46931639-46931661 TCATGTTTCTAGAGGCCAGCTGG + Intronic
930612270 2:53555640-53555662 CCGGGTGTCTGCAGGGCAGAGGG + Intronic
931170213 2:59795255-59795277 AAATGTTTCTGTAGGGCTGAGGG + Intergenic
931890675 2:66667930-66667952 GGATGTTTTTGGAGGGCAAAGGG + Intergenic
932712607 2:74079040-74079062 CCAAGTTTCTGAAGGGCTGGCGG - Intronic
932885658 2:75547024-75547046 TCATGGTTCTGGAGGCCAGAAGG - Intronic
934614707 2:95763946-95763968 CCCTGTTCCGGGAGGGCAGTAGG + Intergenic
934646197 2:96060549-96060571 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
934839600 2:97616632-97616654 CCCTGTTCCGGGAGGGCAGTAGG - Intergenic
936459282 2:112700582-112700604 CCATAATTCTGGAGGACAGTAGG - Intergenic
937304745 2:120864400-120864422 CCATGTGTCTCGATGGCTGAAGG + Intronic
937335868 2:121062111-121062133 CGCTCTTTCTGGAGGTCAGAGGG + Intergenic
938777304 2:134553345-134553367 CCTTGTAACTGGAGGGCACAAGG - Intronic
938952726 2:136270340-136270362 ACATGTGGCTGGAGGGCAGGAGG + Intergenic
941295624 2:163735947-163735969 CCAAGTTTTTGAAGGGAAGACGG + Exonic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
944463262 2:199974518-199974540 CCATGTTCCTGGAAGGCAGAGGG + Intronic
944637607 2:201689924-201689946 CCCTGTTTATGAAGGGCAAATGG + Intronic
944812031 2:203336716-203336738 CCATTTACATGGAGGGCAGAAGG - Intronic
945742936 2:213685487-213685509 CCACACTTCTGGAGGCCAGAAGG - Intronic
947746316 2:232509058-232509080 GTTTCTTTCTGGAGGGCAGAGGG - Intergenic
947873465 2:233452842-233452864 CCATTTTTCTGGAGTGGTGACGG + Intronic
947948942 2:234131055-234131077 TCATGTGTGTGGAGGGCAGTGGG + Intergenic
948627224 2:239276590-239276612 GCCTGTGTCTGGAGAGCAGATGG - Intronic
1170210127 20:13839595-13839617 TCATAGTTCTGGAGGCCAGAAGG + Intergenic
1171185497 20:23121491-23121513 CCTTGTTTCTGTCGGGCAGATGG + Intergenic
1172601989 20:36190417-36190439 CCATGTGTATGGAGGGGAGCAGG + Intronic
1173561123 20:44006402-44006424 TGATGTTTCTGCAAGGCAGAGGG - Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1176361641 21:6001711-6001733 CCTTATTTCTGGAGGGATGAAGG + Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1178378985 21:32092666-32092688 TCCTGGTTCTGGAGGCCAGAAGG + Intergenic
1179175756 21:39006759-39006781 TCATCTTGCTGGAGGGCAGAAGG - Intergenic
1179709999 21:43207897-43207919 CCATGTGGCTTGAGGGCAGTGGG + Intergenic
1179761877 21:43536839-43536861 CCTTATTTCTGGAGGGATGAAGG - Intronic
1180700722 22:17780246-17780268 CTGTGCATCTGGAGGGCAGAGGG + Intergenic
1181237514 22:21456592-21456614 CCATGTCTCTGAGGTGCAGACGG + Intergenic
1182240389 22:28911377-28911399 CCATGCTGCTGGAGGACACAGGG - Intronic
1182424881 22:30266669-30266691 CCCAGTTCCCGGAGGGCAGAGGG + Intronic
1182438323 22:30345742-30345764 CCATGGTTCAGGAGTGCAGAAGG + Intronic
1183217268 22:36489168-36489190 GCATGGTTCAGGATGGCAGAGGG + Exonic
1183232163 22:36589745-36589767 CCAAGATGCAGGAGGGCAGAGGG - Intronic
1183501487 22:38182036-38182058 CCATGTTTGTGCGGGGCAGAAGG + Intronic
1184109259 22:42385412-42385434 CCATGTGGCTGGAGGGCAATGGG - Intronic
1184905533 22:47483237-47483259 CAAAGTTTCTGGAGGCCAGGAGG - Intronic
950250436 3:11460881-11460903 CCATGTGTATGGAGCCCAGAGGG + Intronic
950649046 3:14395940-14395962 CCAGGTCTCTGCAGGGGAGATGG + Intergenic
950967936 3:17159300-17159322 CCATTTTCTTGGAGGGCAGGTGG + Intronic
951586761 3:24222632-24222654 CCAAATTCCTTGAGGGCAGAAGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952849994 3:37719940-37719962 TTATTTTTCTGGAGGGCAGAGGG + Intronic
953699468 3:45184634-45184656 TCATCTTCCTGGAAGGCAGAGGG - Intergenic
954394948 3:50288497-50288519 TCATTGTTCTGGGGGGCAGAGGG + Exonic
954929738 3:54271138-54271160 CCATGTGTCTAGAGAGCAGTGGG + Intronic
955178266 3:56639086-56639108 ACATCTTTCTGGAGGGTAGGAGG - Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
958114230 3:89194376-89194398 CATTGTTTCTGCAAGGCAGAAGG - Intronic
961248427 3:125477900-125477922 TCTTGTTTCTGAAGGCCAGATGG - Intronic
962677634 3:137768510-137768532 CCAGGTCTAAGGAGGGCAGATGG - Intergenic
962990582 3:140573828-140573850 CCCTGTTTCTGGGGAACAGAAGG + Exonic
963292434 3:143505343-143505365 TCATGTTACTGTAGGGCACAGGG - Intronic
966381295 3:179347606-179347628 CCATTTTCCTTAAGGGCAGAAGG - Intergenic
966868509 3:184275894-184275916 CGGTGTTGCTGGAGGGCAGCTGG + Intronic
968600390 4:1505990-1506012 CCCTGCTTCTGGAGGGCACAGGG - Intergenic
969442740 4:7226944-7226966 CCATGTGGCTGAAGGGCAGTGGG + Intronic
970696190 4:18680247-18680269 CGATGTTTTTGTAGGTCAGATGG + Intergenic
971313835 4:25550285-25550307 ACATTTTTTTGGGGGGCAGAGGG + Intergenic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
974102661 4:57435073-57435095 CCAGGTTCCAGGAGAGCAGATGG + Intergenic
974218992 4:58941390-58941412 TTATGTTTCTGGAGAGCAGGTGG - Intergenic
975855254 4:78617700-78617722 ACATGTTTCTAGAGAGAAGACGG + Intergenic
976103649 4:81593170-81593192 CCACATCTCTGGATGGCAGAGGG - Intronic
976128415 4:81857830-81857852 GCATGTTTCTGGAGGAGAAATGG - Intronic
978169149 4:105648343-105648365 CCTTGTTTCTGGAGGTCAGTGGG + Intronic
979456406 4:120930392-120930414 CCCAGTTTCTGGTGGCCAGAAGG - Intergenic
981010707 4:139922056-139922078 CCAGGTCTGTGGAGGGCAGAGGG + Intronic
983391370 4:167134400-167134422 CGTTGTTACTGGAGGGCAAATGG + Intronic
986545376 5:8891413-8891435 CAGTGTTCCTGGATGGCAGAAGG - Intergenic
986621943 5:9685090-9685112 GTATGTATCTGGAGAGCAGAAGG + Intronic
987535636 5:19184377-19184399 CCCTGTTTCATGAGGGCAAAGGG - Intergenic
988584643 5:32497891-32497913 CCATCATTCTGGGAGGCAGAAGG + Intergenic
988711903 5:33787493-33787515 ACATGTTTCTTGAGAGAAGAAGG + Intronic
990278906 5:54228987-54229009 CCATGTTTCTGGGGGGCATCTGG + Intronic
991293028 5:65051055-65051077 CTAAGTTTCTGCAGGGCTGATGG + Intergenic
991530951 5:67613556-67613578 CCATGTCTCTGGAGAGTAGATGG - Intergenic
991997315 5:72400761-72400783 CCATTATTCTGGAGGTCACAAGG + Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
993204372 5:84861414-84861436 CTGTGTTTCTGGATAGCAGAAGG - Intergenic
994669050 5:102744458-102744480 CCATTTTTCCGCAGAGCAGAAGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
996487706 5:124056350-124056372 GCAGTTTTCTGAAGGGCAGAAGG + Intergenic
997706284 5:135956466-135956488 CCATGTTTCATGGGGGCAAAGGG + Intergenic
998548213 5:143050100-143050122 CTATGTTGTTGGTGGGCAGAGGG + Intronic
998601347 5:143588365-143588387 TCATGGTTCTGCAGGGCTGAGGG - Intergenic
998884967 5:146684644-146684666 CGATGCATCTGGAGGGTAGATGG - Intronic
999055659 5:148573415-148573437 CCATCTTTCTGGATCACAGAGGG - Intronic
999954709 5:156687815-156687837 CCATGTTGCTGGCTGGTAGAGGG + Intronic
1001218706 5:169880309-169880331 CCATATGCCTGGAAGGCAGAAGG - Intronic
1001256377 5:170186563-170186585 TCATTTTACTGAAGGGCAGATGG - Intergenic
1001626703 5:173142214-173142236 CCATGTTGCTGGAGGGAGTATGG + Intergenic
1001741288 5:174055071-174055093 CCCTGTTTCCGGAGGTCACAGGG + Intronic
1001791491 5:174461215-174461237 CCTGGCTTCTGGGGGGCAGAGGG + Intergenic
1001963646 5:175895281-175895303 CCATGTTTCTGGGGTGCTGCAGG + Intergenic
1003413126 6:5883360-5883382 CCATGTCTCTGGTGTGCAGCAGG + Intergenic
1003829761 6:9994977-9994999 CCATGTTTCTGGTCTTCAGAGGG + Intronic
1003920129 6:10825123-10825145 CCATGTTCAAGGAGGGAAGAGGG - Intronic
1005003289 6:21263933-21263955 CCATGTTTCTGGAGCAAAAAAGG - Intergenic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1005999996 6:30956995-30957017 CCTGGGTTCTAGAGGGCAGATGG - Intergenic
1006105056 6:31711396-31711418 CCCTATTTCTCGGGGGCAGAGGG + Intronic
1006116219 6:31777409-31777431 CCCTGGTTCTGGAGGGCAGAGGG - Intergenic
1006211163 6:32396201-32396223 CCATGTGGCTGGAGAGCAGATGG - Exonic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1008154563 6:47997764-47997786 CCATGTTCCAGGAAGGCAGGTGG + Intronic
1008623785 6:53298174-53298196 CCATGTATATGGAGGTCACAGGG + Intronic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1010311919 6:74397532-74397554 CCATGTAGCTGGAGGACATATGG + Intergenic
1010828237 6:80498726-80498748 CTATGTTTCTAGTGTGCAGAAGG + Intergenic
1013233879 6:108179890-108179912 CCATCTTCCTGGAGGGTTGAGGG - Intronic
1016841919 6:148533509-148533531 CCCTGGTTCTGCAGGGCAGGAGG + Intronic
1017950421 6:159130943-159130965 CCAGGCTTATGGAGGGCGGACGG - Intergenic
1018258709 6:161948744-161948766 CCATGTGTTTGGAGGGCAAGAGG + Intronic
1018302311 6:162416427-162416449 CTATGTTTCTGGAGGTAGGATGG + Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019351641 7:556815-556837 CCATGTTTCTGGAATGGAGAGGG + Intronic
1019730792 7:2628314-2628336 TCACGGTTCTGGAGGCCAGAAGG + Intergenic
1020370493 7:7427035-7427057 CCATGTGTCTCCAGGGCTGAAGG + Intronic
1020660183 7:10972958-10972980 CACTTTTTCTGCAGGGCAGATGG + Intergenic
1021687971 7:23206050-23206072 CCCCGTGTCTGCAGGGCAGAGGG - Intergenic
1021897044 7:25246917-25246939 TCATCTTTCTGGAGGGTAGTGGG - Intergenic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023703168 7:42912155-42912177 CCATGTTTATTGAGGGCACCTGG + Intronic
1025262934 7:57432905-57432927 TTTTGTTTATGGAGGGCAGAAGG - Intergenic
1025811971 7:64881290-64881312 CCATGTTTCTCGTGGGCCTAGGG + Intronic
1026109984 7:67451302-67451324 CCGTATTTCTAGAGGCCAGAGGG + Intergenic
1027299893 7:76820932-76820954 CCATGTGTCTGCAGGTCAGAGGG - Intergenic
1029221092 7:98991080-98991102 CCATGGTTCTCAAGGGCAGTGGG + Intronic
1029226731 7:99034037-99034059 CCATCTTTATGTTGGGCAGAGGG + Intronic
1031360706 7:120845173-120845195 CCAAGGTTCTGCAGGGCAGCAGG + Intronic
1031414625 7:121480669-121480691 CCACAGTCCTGGAGGGCAGAAGG + Intergenic
1034404751 7:150896028-150896050 TCATGGTTCTGGAGGCCAGAAGG - Intergenic
1036805276 8:11827623-11827645 CCATTTTTCTGTGGGGCAGTTGG - Intronic
1037921180 8:22807191-22807213 GCATGTTTGTGGATTGCAGAAGG + Intronic
1040753626 8:50742220-50742242 ACATTTTTCTGAAGGGCACATGG + Intronic
1041598594 8:59687825-59687847 CCAAATTTTTGGAGGGTAGAGGG + Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1044950515 8:97431409-97431431 CACTGTTTCTGGAGGCTAGAAGG - Intergenic
1045970878 8:108078793-108078815 TCATGTTTCTGGTGGTCCGATGG - Intronic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1046845269 8:118908434-118908456 CACTGATTCTGGAGGCCAGAAGG - Intergenic
1047623770 8:126635042-126635064 CCATGTTGGAGGAGGGCGGAGGG - Intergenic
1049412841 8:142481140-142481162 CCCTGTTTCTGGGGGCCACAGGG + Intronic
1049686049 8:143939738-143939760 TCCTGTTTCTGGCGGGCCGAGGG - Intronic
1050120226 9:2300189-2300211 CAATGTTTCTGGAGGCCTAAAGG - Intergenic
1050974955 9:11926306-11926328 CCATGTTTTTGGGGGGAACATGG + Intergenic
1051055568 9:12981009-12981031 CCATGTTTATGGAGGGTGGAGGG - Intergenic
1051327099 9:15983949-15983971 CAATGGTTCTGGTGGGAAGATGG - Intronic
1052465305 9:28822113-28822135 CCATGGGACTGGAGGGCATAAGG - Intergenic
1055111624 9:72565881-72565903 CCATGTGTCTTGAGGGGAGCTGG - Intronic
1055259994 9:74422908-74422930 ACATGTTTCTGTGGGGAAGAGGG - Intergenic
1057581071 9:96288387-96288409 CCATGACTCTGGAGAGCTGAAGG + Intronic
1059990717 9:119862616-119862638 TCATGTTGCTGAAGAGCAGAAGG - Intergenic
1061274997 9:129564879-129564901 CCATGTGTCATGATGGCAGATGG + Intergenic
1187659817 X:21531004-21531026 CAATGTTTCTTGAGGAGAGAAGG - Intronic
1188747423 X:33863377-33863399 TCATGATTCTGGAGGGTAGAAGG + Intergenic
1189433384 X:40969514-40969536 CCACTTTTCTGCATGGCAGATGG - Intergenic
1189655129 X:43237092-43237114 CCATGTTTGGGGAAGGGAGAGGG - Intergenic
1189911197 X:45812041-45812063 CTATGTTTCAGGAGGCAAGAAGG - Intergenic
1189960973 X:46324505-46324527 CCATTATTCTGGAGGCCACAAGG - Intergenic
1189992321 X:46607063-46607085 CCACGAGTCTGGAGGGCAGCCGG - Exonic
1192083138 X:68067469-68067491 CAATGATTTTGGGGGGCAGAGGG + Intronic
1194295158 X:92118204-92118226 CAGTGTTTCTGAAGGGCATATGG - Intronic
1196556213 X:117087571-117087593 CATTGTCTCTGGATGGCAGAGGG - Intergenic
1197446724 X:126559423-126559445 TCATATTTCTGGAGGCTAGAAGG + Intergenic
1198730428 X:139722116-139722138 CCATGTTTATGGAGAACATAAGG + Intergenic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200049854 X:153422983-153423005 CCCTGTTTCTGCAGGGCTAAGGG - Intergenic
1200612658 Y:5342728-5342750 CAGTGTTTCTGAAGGGCATATGG - Intronic